ID: 1082999658

View in Genome Browser
Species Human (GRCh38)
Location 11:59279854-59279876
Sequence TAGTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082999658_1082999661 1 Left 1082999658 11:59279854-59279876 CCTGCCATCTTCTGCAGATACTA No data
Right 1082999661 11:59279878-59279900 TCTCCTTTGGAGAGAGTTCTTGG No data
1082999658_1082999664 13 Left 1082999658 11:59279854-59279876 CCTGCCATCTTCTGCAGATACTA No data
Right 1082999664 11:59279890-59279912 AGAGTTCTTGGCCTGTTACTGGG No data
1082999658_1082999663 12 Left 1082999658 11:59279854-59279876 CCTGCCATCTTCTGCAGATACTA No data
Right 1082999663 11:59279889-59279911 GAGAGTTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082999658 Original CRISPR TAGTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr