ID: 1083001749

View in Genome Browser
Species Human (GRCh38)
Location 11:59298593-59298615
Sequence ACCCTGTCTCCAAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083001743_1083001749 21 Left 1083001743 11:59298549-59298571 CCTTTAGCACAAGAGTTCAAGGT No data
Right 1083001749 11:59298593-59298615 ACCCTGTCTCCAAAGAAGGAAGG No data
1083001741_1083001749 22 Left 1083001741 11:59298548-59298570 CCCTTTAGCACAAGAGTTCAAGG No data
Right 1083001749 11:59298593-59298615 ACCCTGTCTCCAAAGAAGGAAGG No data
1083001747_1083001749 -5 Left 1083001747 11:59298575-59298597 CCTGGGCAAAATAGTGAAACCCT 0: 12
1: 742
2: 13613
3: 87809
4: 227558
Right 1083001749 11:59298593-59298615 ACCCTGTCTCCAAAGAAGGAAGG No data
1083001746_1083001749 -4 Left 1083001746 11:59298574-59298596 CCCTGGGCAAAATAGTGAAACCC No data
Right 1083001749 11:59298593-59298615 ACCCTGTCTCCAAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083001749 Original CRISPR ACCCTGTCTCCAAAGAAGGA AGG Intergenic
No off target data available for this crispr