ID: 1083009323

View in Genome Browser
Species Human (GRCh38)
Location 11:59381218-59381240
Sequence TTGGTATTCCTGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083009323_1083009325 -7 Left 1083009323 11:59381218-59381240 CCTTTTTTCCTCAGGAATACCAA No data
Right 1083009325 11:59381234-59381256 ATACCAATAATTTATTATTTAGG No data
1083009323_1083009327 24 Left 1083009323 11:59381218-59381240 CCTTTTTTCCTCAGGAATACCAA No data
Right 1083009327 11:59381265-59381287 GATAGTCTTAAAAGTCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083009323 Original CRISPR TTGGTATTCCTGAGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr