ID: 1083013053

View in Genome Browser
Species Human (GRCh38)
Location 11:59422470-59422492
Sequence ATGTTTCAATGAAAGAACTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083013051_1083013053 6 Left 1083013051 11:59422441-59422463 CCCACAGAAATCATGCTGATAGA 0: 1
1: 0
2: 0
3: 17
4: 207
Right 1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG 0: 1
1: 0
2: 0
3: 27
4: 403
1083013052_1083013053 5 Left 1083013052 11:59422442-59422464 CCACAGAAATCATGCTGATAGAC 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG 0: 1
1: 0
2: 0
3: 27
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083013053 Original CRISPR ATGTTTCAATGAAAGAACTA AGG Exonic
900876531 1:5346691-5346713 ATGTTTCATGGGAAGAACCAAGG + Intergenic
901186568 1:7377181-7377203 ATGCTTGAATGAATGAACTCTGG - Intronic
901987010 1:13083861-13083883 AGGTTTCACTGAAAGAAATCAGG + Intergenic
901994802 1:13142906-13142928 AGGTTTCACTGAAAGAAATCAGG - Intergenic
902111772 1:14085054-14085076 ATCTTTGAATGAAAGAACCCAGG - Intergenic
902845733 1:19109238-19109260 ATGGCCCAAAGAAAGAACTATGG + Intronic
903089820 1:20903204-20903226 ATGTGTAAATGAAAGAAGCAAGG - Intronic
904827993 1:33288005-33288027 ATGTTTCAATAAAATTATTAAGG - Intronic
905564808 1:38955565-38955587 ACATTTTAATTAAAGAACTAAGG + Intergenic
906273291 1:44498149-44498171 ATCTATAAATGAAAGAAATAGGG - Intronic
906663604 1:47601003-47601025 AAATTTACATGAAAGAACTAAGG + Intergenic
907352949 1:53848491-53848513 CTGTTTCTATGAAAGAATTCAGG + Intergenic
907975744 1:59429885-59429907 AAGAATCAAAGAAAGAACTATGG - Intronic
908009970 1:59765862-59765884 AGGATTCAGTGAAAGAACTGTGG + Intronic
908174002 1:61536124-61536146 ATGTTTCAGAGAAAAAATTAGGG - Intergenic
908526020 1:64988383-64988405 ATGGTTAAATGAATGAACTTTGG - Intergenic
909099951 1:71337568-71337590 ATGTTTCAATAATAGAAGGAAGG - Intergenic
909138915 1:71837865-71837887 ATTTTTCCAGGAAAGAAATAAGG - Intronic
909623266 1:77688506-77688528 ATGATCCAATGAAAGAAATTAGG - Intergenic
909905346 1:81187436-81187458 ATGTTTCACTGAAATACCTGAGG + Intergenic
910445853 1:87298488-87298510 ATGTTTCAATGTATGAATTTTGG - Intergenic
911515957 1:98868143-98868165 ATATTTCAAAGAAGAAACTAAGG + Intergenic
912186106 1:107277603-107277625 ATGTTTCAAAGAAAAATCAAAGG + Intronic
916624954 1:166545564-166545586 TTTTTTAAATGAAAGAACAAAGG - Intergenic
916847425 1:168666954-168666976 ATTCTTCTATCAAAGAACTAAGG - Intergenic
917030098 1:170680943-170680965 ATGTATCAATGAAACAACAAAGG + Intronic
918562052 1:185880728-185880750 ATGTTTGAAGGAATGAAATAGGG + Intronic
919506795 1:198409154-198409176 AAGTTTAAATGAAAGATATAAGG + Intergenic
921164562 1:212497308-212497330 ATGTTTCCACAAAAAAACTAGGG - Intergenic
921504059 1:215944725-215944747 TTGCTTAAATGAAAGAAATATGG + Intronic
922928418 1:229370133-229370155 ATGTATAAAATAAAGAACTATGG - Intergenic
923518287 1:234715964-234715986 AAGTTACAATGAAACAATTACGG + Intergenic
923546290 1:234925898-234925920 ATGTCTCAGTGGAAGAACTATGG + Intergenic
923607322 1:235456171-235456193 ATGTTTCAATGTAATAAGTCAGG - Intronic
924041346 1:239987075-239987097 ATGATACAATGTGAGAACTAAGG + Intergenic
924408785 1:243781633-243781655 ATGTTTGAGTGACAGACCTATGG + Intronic
1063486823 10:6427938-6427960 ATCTTTCAAGTAAATAACTATGG + Exonic
1064272507 10:13878269-13878291 CTGTTTCCATGAAAGAAGGAAGG + Intronic
1064515009 10:16137915-16137937 ATGTCACAATGAAATAACTAGGG + Intergenic
1065770080 10:29069957-29069979 AAGTTTCAATGACTTAACTAAGG + Intergenic
1065979250 10:30875368-30875390 ATTTTTCAATGAGAAAACTGAGG + Intronic
1066417551 10:35235454-35235476 ATTTTTCAGTGAAAAACCTAGGG + Intergenic
1066532076 10:36351634-36351656 ATGTTTTAATAGAAGAACTGAGG + Intergenic
1067139340 10:43643443-43643465 ATGTCTCAATGCACAAACTAAGG + Intergenic
1067900340 10:50233873-50233895 ATATTTGAATGGAAAAACTAAGG - Intronic
1067913271 10:50368922-50368944 ATGTTACACTTAAAGAACCAAGG + Intronic
1068266586 10:54657298-54657320 ATGTTTCAATGGAAGAGCGTTGG - Intronic
1068310453 10:55267313-55267335 ATGCTTCAATGACACATCTAAGG - Intronic
1068329152 10:55538687-55538709 ATGTTTTAATGAAAGAAGGAAGG - Intronic
1068439820 10:57037777-57037799 ATGTTTCACAGAAAGAGCTTAGG - Intergenic
1068990891 10:63149402-63149424 ATGATACAATAAAGGAACTAAGG - Intronic
1069217034 10:65833593-65833615 ATGTTTTAATTAATGAAATATGG + Intergenic
1069350636 10:67522099-67522121 ATCTTTCAATGAAATAATTAGGG + Intronic
1071418163 10:85460447-85460469 ATGTTTAAATGAAGTAACTGAGG + Intergenic
1071546484 10:86533854-86533876 AAATTTTAATGAAAGAACAAAGG + Intergenic
1071758922 10:88578265-88578287 TTTTTTCAATGAAAGAACTGAGG + Intronic
1071841181 10:89473208-89473230 ATTTTTAAAAGAAAGAACAAAGG + Intronic
1072910974 10:99500408-99500430 ATCTTGCAAAGAAAGAGCTATGG - Intergenic
1073690627 10:105804915-105804937 ATCTTTCAGAGAAAGAACGAAGG - Intergenic
1075363381 10:121860493-121860515 ATGTTTCCATGAAAGCAAAAAGG + Intronic
1075904502 10:126069332-126069354 AACTTTCAAAGAAAGAACTTTGG + Intronic
1077604388 11:3598242-3598264 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1079494258 11:21023267-21023289 ATTTTACAATGAGAAAACTAAGG - Intronic
1079794807 11:24788134-24788156 CTGTTACAGTGAAAGAATTAAGG - Intronic
1080362008 11:31526031-31526053 ATGTTTCAATAAAATATTTAAGG - Intronic
1080481351 11:32653785-32653807 ATCTATCAAGGAAAAAACTAAGG + Intronic
1080632884 11:34095466-34095488 ATTTTACGATGAAAGCACTAGGG - Intronic
1080742181 11:35076674-35076696 ATGTTACAATGACAGAATTGAGG + Intergenic
1080756343 11:35203339-35203361 AAGTTTAAATAAAAGAAATAAGG - Intronic
1083013053 11:59422470-59422492 ATGTTTCAATGAAAGAACTAAGG + Exonic
1084226837 11:67721058-67721080 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1084260280 11:67972839-67972861 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1084808354 11:71595796-71595818 TTGTTTCAATGAAGAAACTGTGG + Intronic
1084812490 11:71622410-71622432 TTGTTTCAATGAAGAAACTGTGG + Intergenic
1084845460 11:71895805-71895827 TTGTTTCAATGAAGAAACTGTGG + Intronic
1085585689 11:77703055-77703077 ATGTTTCAATGAATAAATTGAGG - Intronic
1085709351 11:78814981-78815003 TTGTTTCAAAGAAATAACTTAGG - Intronic
1086035172 11:82405834-82405856 ATGTTTCATATAAAGAATTAAGG - Intergenic
1086374615 11:86187646-86187668 TTTTATAAATGAAAGAACTAAGG + Intergenic
1086444096 11:86855969-86855991 TTGTTTCAATTAAAAAACTGTGG - Intronic
1087110407 11:94460810-94460832 ATGTTTCTATGAAGTAAGTAGGG - Intronic
1087508398 11:99058016-99058038 ATATTTCTAGGAAAAAACTAGGG - Intronic
1087660848 11:100986370-100986392 ATGTTTGAAGGAAAGAAAGAGGG + Intronic
1088056556 11:105587750-105587772 ATGGTTCAATGAATTAAATATGG - Intergenic
1089017122 11:115174898-115174920 ATGTTTTAAAGAAAGAAGTGTGG - Exonic
1089098931 11:115944127-115944149 ATGATTCAATGAAAAAGCTGTGG - Intergenic
1089818500 11:121199186-121199208 CTTTTTAAATGAAAGAAATATGG + Intergenic
1089962966 11:122631974-122631996 ATATTTCAAAGAAAGAAATTTGG - Intergenic
1092004189 12:5055283-5055305 ATATTTTAATAAAAGCACTAAGG - Intergenic
1092431542 12:8413393-8413415 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1092434497 12:8436010-8436032 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1092903955 12:13085368-13085390 ATGTTTCAGGTAAAGAACTGTGG + Intronic
1093191063 12:16075804-16075826 ATGTATTAAGGATAGAACTAAGG - Intergenic
1093398901 12:18718532-18718554 ATGTTTAAATGAGAGAAAAATGG - Intronic
1093406180 12:18807535-18807557 ATGTTACTGGGAAAGAACTATGG - Intergenic
1093471614 12:19507976-19507998 ATATTTCAATTAATGAAATAAGG - Intronic
1093842348 12:23919463-23919485 ACATTTAGATGAAAGAACTATGG - Intronic
1093927319 12:24922007-24922029 ACACTTTAATGAAAGAACTAGGG + Intronic
1094109931 12:26851689-26851711 ATGTGGAAATGAAAAAACTAAGG + Intergenic
1094294752 12:28892205-28892227 ATCTTTGAATGAAAGAATGATGG + Intergenic
1095287737 12:40435728-40435750 TTCTTTCAATTAAAGAATTATGG + Intronic
1095403950 12:41846559-41846581 ATGATTTAATGAATGAATTAAGG + Intergenic
1096507131 12:52100949-52100971 TTGTTTCAATTAAGAAACTATGG + Intergenic
1098584071 12:72135576-72135598 ATTTTTAAATAAAAGGACTAGGG + Intronic
1099451152 12:82808246-82808268 ATGTTTCAGAAAAAGAAATATGG + Intronic
1100124667 12:91408870-91408892 ATATTTAAATGAAAAGACTAGGG + Intergenic
1100124814 12:91411119-91411141 ATATTTAAATGAAAAGACTAGGG + Intergenic
1100138656 12:91588211-91588233 AGTTTTCAGTGAAAGAAATAGGG - Intergenic
1102199481 12:111047528-111047550 AGGATTCAATGAAAGAACAAAGG - Intronic
1102957868 12:117071206-117071228 ATGAATGAATGAAAGAACAAAGG - Intronic
1103975279 12:124698490-124698512 ATGTTTTAAGGAAAGAATTTGGG + Intergenic
1103977947 12:124715919-124715941 ATGTTGCATTGAAATAATTATGG + Intergenic
1105246203 13:18652700-18652722 ATGTTACAAAGAATGAAGTAGGG + Intergenic
1107382016 13:39866994-39867016 ATGTTTAAATGAAACATCAAAGG - Intergenic
1107387156 13:39924118-39924140 ATGGGTCAATGAAAAAATTAAGG - Intergenic
1107557688 13:41532035-41532057 ATGTTTCAATGTATGAATTCTGG + Intergenic
1108207392 13:48104529-48104551 AGGTTTGACTGAAGGAACTAGGG - Intergenic
1109408483 13:61933378-61933400 AAGTTTATATAAAAGAACTATGG - Intergenic
1109442218 13:62389998-62390020 ATTATTCAATGAGAGAACTCAGG - Intergenic
1109551559 13:63908820-63908842 ATGTTTCTAGGAAATAGCTAAGG - Intergenic
1109637946 13:65148412-65148434 ATATAGCAATGAAAGAAATAAGG - Intergenic
1109874948 13:68388807-68388829 ATATTTCAATGTAAGAAGTATGG - Intergenic
1109895540 13:68683340-68683362 ATTTTTTAATGAAAAACCTAGGG - Intergenic
1110064894 13:71091271-71091293 ATGTTTCAAGGAAAGCCATACGG - Intergenic
1111392950 13:87623211-87623233 ATGATTAAAGGAAAGAACTGTGG - Intergenic
1111523100 13:89430624-89430646 AAGTATGAATGAAAGAAGTAAGG + Intergenic
1111611122 13:90608896-90608918 ATATTTCAATATAAGAACTTAGG + Intergenic
1111789221 13:92832034-92832056 TTTTTTCAATGAAAAAACTGAGG + Intronic
1112454529 13:99546600-99546622 ATTTTTTAATGAAAGAACAGTGG + Intronic
1114628164 14:24142753-24142775 AGGTTTCACTGGGAGAACTATGG - Intergenic
1115844220 14:37507804-37507826 ATGGTTAAATGCAAAAACTAAGG - Intronic
1117748494 14:58896523-58896545 AAGTTGAAATGAAAGAACGATGG - Intergenic
1117772147 14:59144606-59144628 GTGTTTGAATGAATGAACAATGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118543807 14:66861747-66861769 ATGGGTCAATGAAGGAATTAAGG + Intronic
1118813949 14:69295753-69295775 TGGTTTCGATGAAAGAACAATGG - Intronic
1119485487 14:74984256-74984278 ATTTTTGAATGAAGGGACTAGGG + Intergenic
1120254389 14:82099973-82099995 ATGTTTTAATCAGAGAACTCAGG - Intergenic
1120562113 14:86007956-86007978 ATTTTTAAATGAAAGAAAGAGGG - Intergenic
1120790069 14:88572476-88572498 AAATTTCAATGAAAAAACTGAGG - Intronic
1121668216 14:95688518-95688540 ATTTCTCAAAGAAAGAATTACGG + Intronic
1121878363 14:97476162-97476184 ATCTTTCAATGAAAGTATTAGGG + Intergenic
1123824266 15:24065550-24065572 TTGTTTAAATGAATGACCTATGG - Intergenic
1124788368 15:32703033-32703055 TTGGTTACATGAAAGAACTAAGG - Intergenic
1125257563 15:37783118-37783140 GTGCTTCATTGACAGAACTAAGG - Intergenic
1125347667 15:38734403-38734425 AGGTTTCAATGTAAGAATTTTGG + Intergenic
1125687832 15:41573902-41573924 ATGTTTCTATCAAAAAACAAAGG - Intronic
1126618839 15:50616375-50616397 ATGTTTCTAAGAAAGAATTATGG - Intronic
1126986678 15:54319190-54319212 AGGTGACAATAAAAGAACTAGGG - Intronic
1127731858 15:61809091-61809113 CTATTTCAATGAAAGAAAGAGGG - Intergenic
1127934529 15:63624191-63624213 ATGGTTCAAGGCAAAAACTATGG - Exonic
1128411082 15:67398425-67398447 GTGTTTAAATGACAGAACTCTGG - Intronic
1128703295 15:69820194-69820216 ATGTTTCCCTGAAAAAACTTGGG + Intergenic
1129538423 15:76332729-76332751 ATGTTTCAAAGAAGAAACTAAGG - Intergenic
1129951020 15:79591712-79591734 ATGTTACACTGAAAGAAGTAGGG - Intergenic
1130154338 15:81336743-81336765 ATGGTCCAAGGTAAGAACTATGG - Intronic
1130166012 15:81460016-81460038 AGGTATCAATGGAAGAACAAAGG - Intergenic
1131325300 15:91437860-91437882 AGGTTTCAATGGAAGGCCTAAGG - Intergenic
1131601032 15:93849141-93849163 ATGAATCAATGAAATAATTAGGG - Intergenic
1132308296 15:100834759-100834781 ATGTTTTAATGAGACAAATAGGG + Intergenic
1135122235 16:19776188-19776210 ATATTTCTAAGAAAGAACTGAGG + Intronic
1136538709 16:30915968-30915990 AAGTTTAATTGAAAGAACTGTGG + Intergenic
1139810054 16:69607237-69607259 ATGTCATAATGAAAGAACAAAGG - Intronic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1139819085 16:69705614-69705636 ATGTTTAAATGAAAGGAAAAAGG + Intergenic
1140351657 16:74267531-74267553 ATGTTCCAAAGAGAGAAGTAAGG - Intergenic
1140670301 16:77270993-77271015 ATTTCTGGATGAAAGAACTAAGG - Intronic
1140699663 16:77569796-77569818 AGGTGTCAGTGAAAGAACTCAGG + Intergenic
1140811492 16:78583219-78583241 ATGGTTCAACCAAAGAACCAGGG + Intronic
1141384759 16:83610287-83610309 ATGTTTCAATAAAACAACTGAGG - Intronic
1142570354 17:869615-869637 AGGTTTCAATGAAATCACTCAGG + Intronic
1149023181 17:51993824-51993846 ATTTATCAATAAAAGAACAAAGG - Intronic
1150788971 17:68184751-68184773 ATGGTTCAATGGAAGTACCAGGG + Intergenic
1153245510 18:3069369-3069391 ATGTGATAAGGAAAGAACTAGGG + Intronic
1153319049 18:3753513-3753535 AAATTTCAAAGAAAGACCTAGGG + Intronic
1153722095 18:7915421-7915443 ATGTTACAATTAAAGTAGTATGG + Intronic
1153801482 18:8674624-8674646 ATTTTACAATGGAAGAACTCAGG + Intergenic
1154263216 18:12856127-12856149 ATGTCTCTGGGAAAGAACTACGG - Intronic
1155814224 18:30284208-30284230 ATGTGTCAATGACTGGACTAAGG - Intergenic
1158188856 18:54802643-54802665 ATATTCCATTGAAATAACTAAGG - Intronic
1158445520 18:57517245-57517267 ATGTTTCAATTTAAGAACTCTGG - Intergenic
1159215386 18:65385446-65385468 ATTTTTCAATAAAAGAAATATGG + Intergenic
1159413210 18:68108211-68108233 ACTTTACAATAAAAGAACTAAGG - Intergenic
1160363989 18:78308712-78308734 ATGTTTCATTAAATGAACAAAGG + Intergenic
1164238650 19:23362993-23363015 ATATGTCTATGAAAGAATTAGGG - Intronic
1166456035 19:42940023-42940045 GTGTTTCAATGAAAGACATCAGG - Intronic
926594699 2:14777382-14777404 ATGTTTAAATGATGGAAATAAGG + Intergenic
928315618 2:30242608-30242630 ATGTTTCAGTGATAGAAATATGG - Intronic
928353450 2:30585131-30585153 ATGTTTTAATGAAGGCAATAAGG - Intronic
929312970 2:40446723-40446745 ATGGTTCAGTGAAATAACTTGGG - Intronic
931120179 2:59208115-59208137 ATGTGTCAATGAAAGAAGGAAGG + Intergenic
931314845 2:61119241-61119263 ATTTTTAAATAAAAGAATTAGGG - Intronic
932471576 2:71962769-71962791 ATGTTTCAAGGCACTAACTAGGG + Intergenic
933073809 2:77896860-77896882 TTTTTTGAAAGAAAGAACTAAGG - Intergenic
933687308 2:85153028-85153050 ATGTAGCAATGTGAGAACTAAGG - Intronic
933872661 2:86584095-86584117 AGTTTTTAAAGAAAGAACTATGG + Intronic
934053772 2:88234095-88234117 TTGTTTCAATTAAAAAACAATGG + Intergenic
935077540 2:99760367-99760389 CTGTTTCTATGAAAAAACTTAGG - Intronic
937002801 2:118483610-118483632 TTGTTTCAATGAAAAGAATATGG + Intergenic
937100822 2:119266576-119266598 ATTTTCCAAAGAAAGAACCATGG + Intergenic
937594166 2:123653207-123653229 ATATTTCAAAGAAAGAAAGAAGG + Intergenic
937756617 2:125547048-125547070 CTGTTTCAAAGAAAGAAAGAAGG - Intergenic
939515383 2:143160877-143160899 ATACTTCAAAGAAAGAGCTAGGG + Intronic
940099483 2:150017754-150017776 CTGTTTCCATTAAAGTACTAAGG + Intergenic
940432600 2:153610866-153610888 TTGTTTCAATGAAAGAAAGAAGG + Intergenic
941258210 2:163260692-163260714 ATGGTTCAATGTAATAACTTTGG + Intergenic
942881331 2:180864817-180864839 TTGCTTTAATGAAAGACCTAAGG + Intergenic
943901995 2:193451537-193451559 ACTTTTCAATGAAAGAAGTCAGG + Intergenic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
945688062 2:212996804-212996826 ATTCTGCAATGAAAGAACTAAGG + Intergenic
1169544349 20:6635338-6635360 ATGATTAAATGAAAGAAAGAAGG - Intergenic
1169955332 20:11096527-11096549 ATGGGTCAATGAAAGGACTTTGG + Intergenic
1170123867 20:12940455-12940477 ATCTTTCAATGAAAGGAATGAGG + Intergenic
1170141700 20:13131388-13131410 AATTTGCAATGAAGGAACTAAGG - Intronic
1170790458 20:19504674-19504696 ATGTTTGAATGGATGACCTAGGG - Intronic
1174803708 20:53587919-53587941 CTGTTTCAAGGAAATTACTAGGG + Intronic
1176453371 21:6884227-6884249 ATGTTACAAAGAATGAAGTAGGG + Intergenic
1176831546 21:13749275-13749297 ATGTTACAAAGAATGAAGTAGGG + Intergenic
1177040944 21:16109877-16109899 ATGTTTCAGTGATAGGACTAGGG - Intergenic
1177373188 21:20233521-20233543 ATGTTTAAATGATTTAACTAAGG - Intergenic
1177604852 21:23364791-23364813 AAGTTTCTTTGAATGAACTATGG + Intergenic
1178083509 21:29090261-29090283 ATTATTCAATGAAAGAAGTGAGG + Intronic
1179025348 21:37674913-37674935 ATGATTGAATGAAAGAAATCTGG + Intronic
1179264160 21:39787632-39787654 ATCTTTGAATTAAAGAAATATGG + Intronic
1181504564 22:23343604-23343626 ATGTCTAGATGAAGGAACTAAGG - Intergenic
1181655680 22:24296216-24296238 ATGTCTAGATGAAGGAACTAAGG - Intronic
1181709561 22:24673835-24673857 ATGTCTAGATGAAGGAACTAAGG - Intergenic
1182525220 22:30912388-30912410 ATGCTTCAAAGAAAAAAATATGG + Intergenic
1183534693 22:38392296-38392318 CTGTTTCAAGGAAATTACTAGGG + Intronic
1184025296 22:41851354-41851376 ATGTTTAAAAAAAAAAACTATGG + Intronic
949756613 3:7418677-7418699 ATGTTTCAATGGAGATACTAAGG + Intronic
950313178 3:11976736-11976758 ATGGCTCAATGAAAGAACATGGG + Intergenic
951117011 3:18875736-18875758 ATGTTTAAACAAAAGAACCAGGG - Intergenic
952232983 3:31451138-31451160 ATGACTGAATGAAAGAAATAAGG + Intergenic
953438126 3:42896123-42896145 TTGTTTCTGTGAAAGAACAAAGG + Intronic
953528500 3:43715755-43715777 ATGTTTCAAAAAAAGAAAAAAGG + Intronic
954359627 3:50113558-50113580 ATACCTCAATGAAAGAAATATGG - Intronic
954910283 3:54100280-54100302 ATGCTTGAATGAAAGAAGCAGGG - Intergenic
955035094 3:55260029-55260051 ATTTTTAAATCAAAGAACAAGGG - Intergenic
955617480 3:60824535-60824557 ATGATTCAAAGAAGGAACAATGG + Intronic
956000450 3:64724364-64724386 ATGTTACAATGGAGGAACTGAGG + Intergenic
956152160 3:66255004-66255026 CTGTGGCAATGAAAGAACCAGGG + Intronic
956470571 3:69562591-69562613 ATATGTAAATGAATGAACTATGG - Intergenic
957664016 3:83199946-83199968 ACTTTTCTATGAAAGAATTAGGG - Intergenic
957878819 3:86183794-86183816 ATCTTTCACTGAAGGAGCTATGG - Intergenic
958012581 3:87899327-87899349 CTGTTTTAATGAAAGAATTCTGG - Intergenic
960484285 3:118232494-118232516 ATGCTTCAATAAATGAAGTAGGG + Intergenic
960508734 3:118523802-118523824 ATATTTCAGGAAAAGAACTAAGG - Intergenic
961278864 3:125749470-125749492 TTGTTTCAATGAAGAAACTGTGG + Intergenic
963117555 3:141744343-141744365 AAGATTAAATGAAAGAAATAAGG - Intronic
963117556 3:141744374-141744396 AAGATTAAATGAAAGAAATAAGG - Intronic
963529754 3:146460229-146460251 ATGTTTTAATGAAATATCTGTGG + Intronic
963535981 3:146528978-146529000 ATTTTTCAATGAAATATCTGTGG + Intronic
963962291 3:151322960-151322982 AGGTATCAGTGAAAGAGCTAGGG - Intronic
964926676 3:161967186-161967208 ATGTTTCAATAAAAGATGTTGGG + Intergenic
964989616 3:162792196-162792218 CTATTTCATTGAAAGAACTAGGG + Intergenic
968987887 4:3887906-3887928 TTGTTTCAATGAAGAAACTGGGG - Intergenic
969018881 4:4125213-4125235 TTGTTTCAATGAAGAAACTGTGG - Intergenic
969023526 4:4155089-4155111 TTGTTTCAATGAAGAAACTGTGG - Intergenic
969144782 4:5113084-5113106 AGGTTTCAATGTAAGAATTTTGG - Intronic
969730286 4:8951992-8952014 TTGTTTCAATGAAGAAACTGTGG + Intergenic
969786461 4:9461622-9461644 TTGTTTCAATGAAGAAACTGTGG + Intergenic
969789889 4:9486104-9486126 TTGTTTCAATGAAGAAACTGTGG + Intergenic
969794370 4:9515270-9515292 TTGTTTCAATGAAGAAACTGTGG + Intergenic
970043298 4:11821167-11821189 ATGTGTAAAATAAAGAACTAGGG + Intergenic
970258935 4:14203110-14203132 ATGTTTAAATGAGATAACAAAGG - Intergenic
970855195 4:20643262-20643284 ATGGTTTAATGATAAAACTAAGG + Intergenic
970980276 4:22087988-22088010 TCATTTCAATGAAAGAAATAAGG - Intergenic
971296216 4:25395392-25395414 ATGCTTCAATGAAGTAGCTATGG - Intronic
974783644 4:66588419-66588441 ATTATTCAATGAAAGTCCTATGG + Intergenic
976752513 4:88464389-88464411 AGGCTACAATGAAAGAACTCTGG - Intronic
976822486 4:89222169-89222191 TTTTTTAAATGAAAGAGCTAGGG + Intergenic
977068369 4:92348598-92348620 AGGTGTAAATGAAAGAAATAGGG + Intronic
977089209 4:92649638-92649660 ATGGTTCAAGGAAATACCTATGG - Intronic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
978129623 4:105179365-105179387 ATCTTTCATTAAAAGAAATAGGG + Intronic
978489162 4:109292856-109292878 ATTTTTTACTGAAAGAATTAGGG - Intronic
978611329 4:110544108-110544130 ATATTTCAAGGAAGGAATTATGG + Intronic
979555697 4:122044395-122044417 ATGCCTCCATGAAAGAATTAAGG + Intergenic
979743056 4:124175612-124175634 GTTTTACAATGAAAGCACTAAGG + Intergenic
979964246 4:127058754-127058776 ATGGATCAATGAATAAACTAAGG + Intergenic
980544592 4:134242771-134242793 ATTTTTTAATGAATGTACTAGGG - Intergenic
980586606 4:134825411-134825433 ATATTTCAATAAAAGAAATTTGG - Intergenic
981502607 4:145468427-145468449 ATTTTTCAAAGAAACATCTAAGG + Intergenic
982717354 4:158822955-158822977 ATTTTTCAATGAAAAAAGGATGG - Intronic
983450147 4:167899155-167899177 ATGTTTAAAAGATAGAAATATGG + Intergenic
983686581 4:170416881-170416903 ATGTGTCAAGCAAATAACTAAGG - Intergenic
984567902 4:181352986-181353008 ATCTCTCAATGAAATAACTGCGG + Intergenic
985828623 5:2212164-2212186 AGGTTTCACGGAAAGAACTCTGG + Intergenic
985969856 5:3366264-3366286 ATTTTTCAAGGAAAGAGCTTGGG - Intergenic
987168859 5:15231634-15231656 ATGTTTTCATGAAGGAACAATGG + Intergenic
987654432 5:20787860-20787882 ATGATTGAATGAGAGAAATAAGG + Intergenic
988922659 5:35958569-35958591 ATGTTTCTCTGAAAGAACAAGGG - Intronic
988981013 5:36569323-36569345 ATTTTTCATTGAACGAACAAAGG - Intergenic
991406424 5:66304959-66304981 ATGTTTCCCTGAAGGAAATAAGG + Intergenic
993342305 5:86739690-86739712 AACTTTAAATGAAAGGACTAGGG - Intergenic
993450944 5:88071260-88071282 AAGATTCAATGCAAGAACTTTGG + Intergenic
993687874 5:90962454-90962476 GTGTTTGAATAAAAGAACAATGG + Intronic
993797621 5:92286925-92286947 ATATTTTAGTGAAAGAACAATGG + Intergenic
994523711 5:100876571-100876593 ATGTTTCAAAGAAAGAAGATTGG - Intronic
994652004 5:102541015-102541037 ATGTTTGAATGAAATAGATAAGG + Intergenic
994732455 5:103508699-103508721 ATGTTTATAAGAAAAAACTAAGG + Intergenic
995023406 5:107392099-107392121 ATGTCTGAATGATAGATCTATGG - Intronic
995409255 5:111836073-111836095 ATTTTTGAATGAATGAACGAAGG - Intronic
995621575 5:114031511-114031533 ATGTTTCACTGTATGAGCTAGGG + Intergenic
996090799 5:119349800-119349822 ATGGTTCAATGCTAGAACCATGG + Intronic
996973601 5:129403181-129403203 TTTGTTCAGTGAAAGAACTAAGG + Intergenic
996976036 5:129435885-129435907 ATGTGACAATGAAAAAAATAAGG - Intergenic
998187177 5:139989655-139989677 CTGTTTGAATGAATGAACTGTGG - Intronic
998195922 5:140071185-140071207 CTGTTTAAATGAACGAACTGTGG + Intergenic
999809426 5:155114025-155114047 ATGTTTTCATGGAAGAATTAGGG + Intergenic
1000475636 5:161703535-161703557 ATGGTTAAATGAAAAAGCTAGGG - Intergenic
1000882424 5:166713694-166713716 TTCTTTCAATGTAAGACCTAGGG + Intergenic
1001030276 5:168257543-168257565 CTTTTTCAATGAAAGAAGTGGGG + Intronic
1003779045 6:9402640-9402662 ATGTTCCAATAAAAGCAATAAGG - Intergenic
1004877628 6:19971625-19971647 AGGCTTTAATAAAAGAACTAAGG + Intergenic
1005674441 6:28139426-28139448 ATGTTTCATTGAGTAAACTAAGG + Intergenic
1006263875 6:32899483-32899505 ATTTTAACATGAAAGAACTAAGG + Intergenic
1006729243 6:36223489-36223511 ATGTTACAGTGATGGAACTATGG - Intronic
1006792179 6:36709891-36709913 CTCTTTCACAGAAAGAACTAAGG + Intronic
1007189469 6:40001080-40001102 ATGTTCAAATGTAAGAACTCAGG - Intergenic
1009012139 6:57855449-57855471 ATGTTTAAATGAAAAAACAGCGG + Intergenic
1009375178 6:62959364-62959386 ATGGGTCAATGAAGAAACTAAGG - Intergenic
1009773958 6:68180691-68180713 ATGTTTTATTGAAGAAACTAAGG - Intergenic
1011099507 6:83707348-83707370 ATGTATTTAGGAAAGAACTAGGG + Intronic
1011758446 6:90530682-90530704 ATGTTTGTATAAAAAAACTAAGG + Intronic
1012205366 6:96454934-96454956 ATGTTGAAATGAAACTACTACGG + Intergenic
1013062962 6:106655198-106655220 ATGTTTGAATGAATGAATGAGGG + Intronic
1013218534 6:108054292-108054314 ATTTTACAATGAGAGAACTGAGG + Intronic
1014682350 6:124447395-124447417 ATGTTTTCATGAAAGAAGGATGG + Intronic
1015073899 6:129131594-129131616 CTGTTTCTTTGAAGGAACTAGGG + Intronic
1015904407 6:138102349-138102371 ATGTGTCAATGAAAGAAAGCTGG + Intronic
1016613426 6:146019845-146019867 ATGTATCAATGAAATATCTGTGG - Intergenic
1016640011 6:146337422-146337444 ATGTTTCAATCAAATCACTTGGG + Intronic
1017276456 6:152574696-152574718 ATGTTTGCATGAAAGTATTAAGG + Intronic
1017892881 6:158653906-158653928 ATGATTGGATGAAAGAAATAGGG + Intronic
1018449673 6:163895811-163895833 ATGTTTCAAAGACTGCACTAGGG + Intergenic
1019010159 6:168838626-168838648 TTGTTTCAATGCAAGCAATAGGG + Intergenic
1019105330 6:169662744-169662766 ACGTGTCAAGGAAAGCACTAAGG + Intronic
1019105344 6:169662876-169662898 ACGTGTCAAGGAAAGCACTAAGG + Intronic
1020310632 7:6865258-6865280 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1020660653 7:10977295-10977317 ATGACTCATTGAATGAACTACGG + Intronic
1020675613 7:11181551-11181573 ATGTGTCAGTGAAAGAAGAAGGG - Intergenic
1020681859 7:11246407-11246429 AGGTTAGAGTGAAAGAACTAAGG + Intergenic
1024032272 7:45471527-45471549 ATGTAACAATGTAAGAACCATGG + Intergenic
1024709846 7:52003128-52003150 ATATTTCAATGATAGAAATCAGG + Intergenic
1024770652 7:52717972-52717994 CTGTTGAAAGGAAAGAACTAGGG - Intergenic
1025114276 7:56244347-56244369 AGGTTTTAAAGAATGAACTATGG - Intergenic
1025998678 7:66544505-66544527 ATGTCTCAAAGAAAGAAAAATGG + Intergenic
1028586897 7:92461111-92461133 ATGATTCTAGGAAAGAACTTGGG + Intergenic
1029040146 7:97564887-97564909 ATGTTTCAAAAACTGAACTACGG + Intergenic
1029077340 7:97945589-97945611 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1030413925 7:109215885-109215907 ATGTTCCAATGAAATCATTAGGG + Intergenic
1031566283 7:123301060-123301082 ATGAGTCAATGAAAGAAATTAGG + Intergenic
1032924476 7:136587803-136587825 ATGTATGCATGAAATAACTAAGG - Intergenic
1035818389 8:2564892-2564914 ATGTTTCAATGAAGAAGCTCTGG + Intergenic
1035865055 8:3073198-3073220 TTATTTCAATTAAAGCACTATGG + Intronic
1036063218 8:5348894-5348916 ATGTTTCAAGGAAAGATTAAAGG + Intergenic
1036539877 8:9695918-9695940 ATGTTTCAAGGGAAGCACTAGGG + Intronic
1036832504 8:12032222-12032244 TTGTTTCAATGAAGAAACTGTGG - Intergenic
1037124562 8:15331232-15331254 ATGCCTCAAGGACAGAACTATGG - Intergenic
1038936490 8:32257394-32257416 ATTTTCCAATAAAAGAAATATGG - Intronic
1039048348 8:33470471-33470493 ATGTGTCACAGTAAGAACTAAGG + Intronic
1039096054 8:33887235-33887257 ATTTTCTAATGAAGGAACTAAGG + Intergenic
1041536105 8:58927134-58927156 ACATTTCAATGAAAGAAGGATGG - Intronic
1042147654 8:65748001-65748023 TATTTTCAATGAAAGAACTAAGG + Intronic
1042154255 8:65825165-65825187 ATCTCTCAGTGGAAGAACTATGG + Intronic
1042437558 8:68784927-68784949 ATTCTCCAATGAAAGAACCAGGG - Intronic
1042438148 8:68792064-68792086 ATGTGTAAATGTAAGAACTGGGG + Intronic
1043007630 8:74839787-74839809 ATGTATCAATGGAAGAAAGAAGG - Intronic
1043029732 8:75119183-75119205 GTGTTTAAGTGAAAGAATTAGGG - Intergenic
1043210700 8:77512287-77512309 ATTTTTCATTGTAAGAATTAGGG - Intergenic
1044199530 8:89417127-89417149 ACCTTTCAATGAAAGAACATAGG - Intergenic
1044387450 8:91606336-91606358 ATATTTGAATGAGAAAACTAAGG + Intergenic
1044511652 8:93087437-93087459 ATATTTCAATGGAAAAACTCAGG - Intergenic
1044640449 8:94374885-94374907 ATGGTTCACATAAAGAACTATGG + Intronic
1044689757 8:94864992-94865014 TTGTTTCAACGAAAAAAATAAGG - Intronic
1045921589 8:107536436-107536458 ATGTTACAATGATAGTACTGTGG + Intergenic
1046158075 8:110320117-110320139 ATGTTTCATTGAAAGTCCTATGG - Intergenic
1046185496 8:110710164-110710186 ATCTTTCAAGGAGAGAACAAGGG + Intergenic
1046373434 8:113343241-113343263 ATGATTCAAAGAAAAAAATATGG + Intronic
1046692826 8:117304932-117304954 ATGTTTCAATGAATTACCTAAGG - Intergenic
1047383032 8:124381832-124381854 ATGTGTCAATGAAAGCATAACGG + Intergenic
1047468325 8:125141843-125141865 ATGTTTCAAAGCAAGAAGAACGG - Intronic
1047799160 8:128291022-128291044 ATTTTTCAATGAAATAACATAGG - Intergenic
1048075677 8:131067660-131067682 ATTTTTCAATGAAGAAACCAGGG - Intergenic
1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG + Intergenic
1048576698 8:135696357-135696379 ATGTATCAATAAAACAACAATGG - Intergenic
1048850262 8:138638454-138638476 ATGTTTCCATGAGAGAACTGTGG - Intronic
1049400103 8:142422117-142422139 ATGCTGAAAGGAAAGAACTACGG + Intergenic
1050226472 9:3463238-3463260 ATTTTTCAATGAAAACGCTAAGG + Intronic
1050412906 9:5384867-5384889 AAGTTTCAGTGAAAGACCTTAGG - Intronic
1050435398 9:5604264-5604286 ATGTGTCAAAGAAAAAATTATGG + Intergenic
1051625493 9:19095914-19095936 ATATATCAATGAAAAAAATAAGG + Intronic
1052684785 9:31741565-31741587 ATGTTTCAATTGAAAATCTAAGG - Intergenic
1053100588 9:35368781-35368803 ATCTTTCAATAAAAGAAGAAGGG - Intronic
1053143756 9:35698233-35698255 ATGTTTCTATGAGAGAATTGAGG - Intronic
1053911806 9:42914329-42914351 CTGTTTCAATGAAAAAAAAAGGG - Intergenic
1055543810 9:77345335-77345357 ATGCTTCAAAGAAAGAAAAATGG + Intronic
1056052118 9:82779682-82779704 ATGTTTCAATGATAAAATTGTGG + Intergenic
1056079809 9:83080163-83080185 AGGTTTCAATGCAAAAATTATGG + Intergenic
1057306630 9:93916240-93916262 ATGTTTGCATGAAAGAAGGAAGG + Intergenic
1058561851 9:106238527-106238549 ATATTTTAATGAAAGAAGAATGG - Intergenic
1059219829 9:112604499-112604521 ACCTTTCATTCAAAGAACTAAGG + Intronic
1060122570 9:121008369-121008391 ATGTTTCCTTGAAAGAAATGTGG - Intronic
1060652372 9:125339499-125339521 ATTTTTCATTAAAAGAAATAAGG - Intronic
1060718360 9:125955620-125955642 GAGTTTCAATAAAAGCACTATGG + Intronic
1203515809 Un_GL000213v1:288-310 ATGTTACAAAGAATGAAGTAGGG - Intergenic
1186666759 X:11724626-11724648 ATGTTTCACTGAAGAAATTATGG + Intergenic
1186722357 X:12319087-12319109 ATGTGTCAATGAAGGGACAAGGG - Intronic
1188036831 X:25327879-25327901 ATATATCAAGGAAAGAACAATGG - Intergenic
1188181735 X:27064584-27064606 ATGATTGAAGGAAAGAAATATGG + Intergenic
1188417365 X:29952024-29952046 AGGTTTCCATGAAAGAAGCAGGG + Intronic
1188504831 X:30871146-30871168 ATGGTTCAAAGCAAGAATTATGG + Intronic
1188697929 X:33219894-33219916 ATAATTCGGTGAAAGAACTATGG + Intronic
1188754058 X:33938285-33938307 GTGTGTCAATGGAATAACTAAGG + Intergenic
1188879970 X:35480553-35480575 ATGTGTCAATGATAAAATTAGGG + Intergenic
1189994331 X:46624505-46624527 ATTTTTCATTTAAAGAACTTAGG + Intronic
1190435798 X:50423574-50423596 TTTTTTAACTGAAAGAACTATGG - Intronic
1194449316 X:94024449-94024471 ATTTTTAAATGACAGAACAATGG + Intergenic
1194909520 X:99623599-99623621 AGGTTTCAATGAAAGGTGTATGG + Intergenic
1196354083 X:114768627-114768649 ATTTTTCAATGAAATAAGTTTGG - Intronic
1196418272 X:115496432-115496454 ATGTTTCACTGGCAGAACTCTGG + Intergenic
1196601856 X:117610671-117610693 ATGTTTGAAGTAATGAACTACGG + Intergenic
1196618537 X:117795560-117795582 TTGTTTCAATAAAAGGGCTAAGG - Intergenic
1197300169 X:124769933-124769955 ATGTTAGAATGAAAGGACTGAGG + Intronic
1197945620 X:131835892-131835914 ACGAATCAATGAAAGACCTAAGG + Intergenic
1198150930 X:133908546-133908568 ATGGTTGAAAGAAAGAACTGGGG - Intronic
1198788596 X:140317775-140317797 TTGCTTCAGAGAAAGAACTAGGG - Intergenic
1201369029 Y:13240411-13240433 ATATTTCAATGCAAGAACAGTGG + Intergenic
1201866136 Y:18657360-18657382 ATGTTGCCATGAAAAAGCTAAGG + Intergenic