ID: 1083014839

View in Genome Browser
Species Human (GRCh38)
Location 11:59442865-59442887
Sequence TATCTCACCCAAAATGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083014836_1083014839 -9 Left 1083014836 11:59442851-59442873 CCAGAGATGTTAGCTATCTCACC No data
Right 1083014839 11:59442865-59442887 TATCTCACCCAAAATGGTGGAGG No data
1083014835_1083014839 18 Left 1083014835 11:59442824-59442846 CCAGTTTTAAGGATAAATAAATT No data
Right 1083014839 11:59442865-59442887 TATCTCACCCAAAATGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083014839 Original CRISPR TATCTCACCCAAAATGGTGG AGG Intergenic
No off target data available for this crispr