ID: 1083017808

View in Genome Browser
Species Human (GRCh38)
Location 11:59474624-59474646
Sequence ATCCGCTGCCTCCCAGAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083017805_1083017808 17 Left 1083017805 11:59474584-59474606 CCAAAGAGGGATAGAGCAGAAGA No data
Right 1083017808 11:59474624-59474646 ATCCGCTGCCTCCCAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083017808 Original CRISPR ATCCGCTGCCTCCCAGAAAG GGG Intergenic
No off target data available for this crispr