ID: 1083025260

View in Genome Browser
Species Human (GRCh38)
Location 11:59545404-59545426
Sequence GTTTTTAAAGAGAATGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083025257_1083025260 -3 Left 1083025257 11:59545384-59545406 CCGAACATTTGGGGATCAAAGTT No data
Right 1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG No data
1083025255_1083025260 -1 Left 1083025255 11:59545382-59545404 CCCCGAACATTTGGGGATCAAAG No data
Right 1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG No data
1083025251_1083025260 29 Left 1083025251 11:59545352-59545374 CCGGAGTTTTATTTTTACTCAAA No data
Right 1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG No data
1083025256_1083025260 -2 Left 1083025256 11:59545383-59545405 CCCGAACATTTGGGGATCAAAGT No data
Right 1083025260 11:59545404-59545426 GTTTTTAAAGAGAATGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083025260 Original CRISPR GTTTTTAAAGAGAATGTGGT GGG Intergenic
No off target data available for this crispr