ID: 1083025370

View in Genome Browser
Species Human (GRCh38)
Location 11:59546271-59546293
Sequence TTGGTGTCCCTTACAAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083025367_1083025370 -8 Left 1083025367 11:59546256-59546278 CCTGATACTATATAATTGGTGTC No data
Right 1083025370 11:59546271-59546293 TTGGTGTCCCTTACAAAAAGGGG No data
1083025366_1083025370 -7 Left 1083025366 11:59546255-59546277 CCCTGATACTATATAATTGGTGT No data
Right 1083025370 11:59546271-59546293 TTGGTGTCCCTTACAAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083025370 Original CRISPR TTGGTGTCCCTTACAAAAAG GGG Intergenic
No off target data available for this crispr