ID: 1083027073

View in Genome Browser
Species Human (GRCh38)
Location 11:59559976-59559998
Sequence TCTCTCCGATTGGGTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083027073_1083027085 14 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027073_1083027083 12 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027083 11:59560011-59560033 GGGTCAGCAGGAGCCATCACAGG No data
1083027073_1083027079 -8 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027079 11:59559991-59560013 CGGAGAGAACCCAAGAGGGAGGG No data
1083027073_1083027080 0 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027080 11:59559999-59560021 ACCCAAGAGGGAGGGTCAGCAGG No data
1083027073_1083027084 13 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG No data
1083027073_1083027078 -9 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027078 11:59559990-59560012 TCGGAGAGAACCCAAGAGGGAGG No data
1083027073_1083027087 26 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027087 11:59560025-59560047 CATCACAGGGGAGCGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083027073 Original CRISPR TCTCTCCGATTGGGTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr