ID: 1083027079

View in Genome Browser
Species Human (GRCh38)
Location 11:59559991-59560013
Sequence CGGAGAGAACCCAAGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083027070_1083027079 3 Left 1083027070 11:59559965-59559987 CCAGCCATATTCCTCAGGCACCC No data
Right 1083027079 11:59559991-59560013 CGGAGAGAACCCAAGAGGGAGGG No data
1083027073_1083027079 -8 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027079 11:59559991-59560013 CGGAGAGAACCCAAGAGGGAGGG No data
1083027069_1083027079 4 Left 1083027069 11:59559964-59559986 CCCAGCCATATTCCTCAGGCACC No data
Right 1083027079 11:59559991-59560013 CGGAGAGAACCCAAGAGGGAGGG No data
1083027071_1083027079 -1 Left 1083027071 11:59559969-59559991 CCATATTCCTCAGGCACCCAATC No data
Right 1083027079 11:59559991-59560013 CGGAGAGAACCCAAGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083027079 Original CRISPR CGGAGAGAACCCAAGAGGGA GGG Intergenic