ID: 1083027084

View in Genome Browser
Species Human (GRCh38)
Location 11:59560012-59560034
Sequence GGTCAGCAGGAGCCATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 173}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083027070_1083027084 24 Left 1083027070 11:59559965-59559987 CCAGCCATATTCCTCAGGCACCC No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1083027069_1083027084 25 Left 1083027069 11:59559964-59559986 CCCAGCCATATTCCTCAGGCACC No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1083027073_1083027084 13 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1083027074_1083027084 4 Left 1083027074 11:59559985-59560007 CCCAATCGGAGAGAACCCAAGAG No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1083027071_1083027084 20 Left 1083027071 11:59559969-59559991 CCATATTCCTCAGGCACCCAATC No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1083027075_1083027084 3 Left 1083027075 11:59559986-59560008 CCAATCGGAGAGAACCCAAGAGG No data
Right 1083027084 11:59560012-59560034 GGTCAGCAGGAGCCATCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083027084 Original CRISPR GGTCAGCAGGAGCCATCACA GGG Intergenic