ID: 1083027085

View in Genome Browser
Species Human (GRCh38)
Location 11:59560013-59560035
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083027073_1083027085 14 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027075_1083027085 4 Left 1083027075 11:59559986-59560008 CCAATCGGAGAGAACCCAAGAGG No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027074_1083027085 5 Left 1083027074 11:59559985-59560007 CCCAATCGGAGAGAACCCAAGAG No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027069_1083027085 26 Left 1083027069 11:59559964-59559986 CCCAGCCATATTCCTCAGGCACC No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027071_1083027085 21 Left 1083027071 11:59559969-59559991 CCATATTCCTCAGGCACCCAATC No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027081_1083027085 -10 Left 1083027081 11:59560000-59560022 CCCAAGAGGGAGGGTCAGCAGGA No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data
1083027070_1083027085 25 Left 1083027070 11:59559965-59559987 CCAGCCATATTCCTCAGGCACCC No data
Right 1083027085 11:59560013-59560035 GTCAGCAGGAGCCATCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083027085 Original CRISPR GTCAGCAGGAGCCATCACAG GGG Intergenic