ID: 1083027087

View in Genome Browser
Species Human (GRCh38)
Location 11:59560025-59560047
Sequence CATCACAGGGGAGCGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083027075_1083027087 16 Left 1083027075 11:59559986-59560008 CCAATCGGAGAGAACCCAAGAGG No data
Right 1083027087 11:59560025-59560047 CATCACAGGGGAGCGAAGAGAGG No data
1083027082_1083027087 1 Left 1083027082 11:59560001-59560023 CCAAGAGGGAGGGTCAGCAGGAG No data
Right 1083027087 11:59560025-59560047 CATCACAGGGGAGCGAAGAGAGG No data
1083027073_1083027087 26 Left 1083027073 11:59559976-59559998 CCTCAGGCACCCAATCGGAGAGA No data
Right 1083027087 11:59560025-59560047 CATCACAGGGGAGCGAAGAGAGG No data
1083027081_1083027087 2 Left 1083027081 11:59560000-59560022 CCCAAGAGGGAGGGTCAGCAGGA No data
Right 1083027087 11:59560025-59560047 CATCACAGGGGAGCGAAGAGAGG No data
1083027074_1083027087 17 Left 1083027074 11:59559985-59560007 CCCAATCGGAGAGAACCCAAGAG No data
Right 1083027087 11:59560025-59560047 CATCACAGGGGAGCGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083027087 Original CRISPR CATCACAGGGGAGCGAAGAG AGG Intergenic