ID: 1083029833

View in Genome Browser
Species Human (GRCh38)
Location 11:59582372-59582394
Sequence CTCTGGATACCAAAGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 3, 2: 7, 3: 38, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083029829_1083029833 3 Left 1083029829 11:59582346-59582368 CCTAAATAATGAAGCCCTGCTAA 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG 0: 1
1: 3
2: 7
3: 38
4: 227
1083029828_1083029833 15 Left 1083029828 11:59582334-59582356 CCTGCAATCAAACCTAAATAATG 0: 1
1: 0
2: 2
3: 14
4: 174
Right 1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG 0: 1
1: 3
2: 7
3: 38
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083029833 Original CRISPR CTCTGGATACCAAAGCTCAG TGG Intronic
900278460 1:1849134-1849156 CTCTCAACACCAAGGCTCAGGGG + Intronic
900406088 1:2493635-2493657 CTCTGGGTACCACGGCCCAGAGG - Intronic
900873891 1:5327441-5327463 CTCTGGACACTGATGCTCAGGGG - Intergenic
904083372 1:27886157-27886179 CTCTGCATCCCAAGGCTCTGAGG - Exonic
906218818 1:44061215-44061237 CTCTGGATACCTGATCTGAGGGG - Intergenic
906499756 1:46333150-46333172 CTCTGGATACCTAATCTGATGGG - Intergenic
910654020 1:89601635-89601657 CTCTGGTTTTCAGAGCTCAGTGG + Intergenic
911296538 1:96124130-96124152 CTCTGGATGCCATAGCTCAGGGG + Intergenic
912406593 1:109443812-109443834 CTCTGAACACCAAGGCTCAGAGG + Intergenic
912688838 1:111788383-111788405 CTCTGGAAACCCAAGCCCCGTGG - Intronic
912908216 1:113729871-113729893 CTCTACATACCAAAGCTTCGGGG + Intronic
913127281 1:115804324-115804346 CTCTGAACACCATAGTTCAGGGG + Intergenic
914441544 1:147711851-147711873 CTATGGTTACCCAGGCTCAGTGG - Intergenic
914709364 1:150198549-150198571 CTCTAGACTCCAAGGCTCAGTGG - Intergenic
915183291 1:154081994-154082016 CATTGGACACCAAAACTCAGTGG + Intronic
917273652 1:173306084-173306106 CTCTGAAATCCAAATCTCAGTGG + Intergenic
917404754 1:174693751-174693773 TTATGGAGTCCAAAGCTCAGTGG + Intronic
917858534 1:179122558-179122580 CTCTGGATAATCAAGCTCATTGG + Intronic
918162002 1:181910119-181910141 CTCTAGAAACCAACTCTCAGCGG + Intergenic
918518186 1:185385601-185385623 ACATGGATACCAAAGCTCAGAGG + Intergenic
918984115 1:191601379-191601401 TTCTGGATATGGAAGCTCAGTGG + Intergenic
919082856 1:192887410-192887432 AACTGAATACCAAAGCTTAGTGG - Intergenic
920017974 1:202928595-202928617 CTGTGGATCCTAAGGCTCAGAGG - Intronic
920244904 1:204580089-204580111 TGCTGCAAACCAAAGCTCAGGGG - Intergenic
923190638 1:231617106-231617128 CTCTGGCTTCCTCAGCTCAGGGG + Intronic
923653460 1:235895172-235895194 ATCTGTATACCAAACCTCCGTGG - Intergenic
1063541461 10:6938285-6938307 CTCTGGATACAAAAGACCAGGGG + Intergenic
1064980537 10:21162108-21162130 CTCTGGATACCAAAGATTGGTGG + Intronic
1066590763 10:36991834-36991856 GTCTGGAGAACAAAGCTGAGAGG - Intergenic
1067716553 10:48694972-48694994 CCCTGGACTTCAAAGCTCAGGGG - Intronic
1069843164 10:71352657-71352679 CACGGGATACCAAAGCTTGGGGG - Intronic
1070656504 10:78275319-78275341 GTCTGGATACCAAAGCATGGGGG + Intergenic
1070792938 10:79200438-79200460 CTCTGGATGACAGAGCTAAGTGG - Intronic
1071797726 10:89024158-89024180 CTCAGGATACCAAAGCTGGAGGG - Intergenic
1072208626 10:93226160-93226182 CTCTGGATACCTACACTCGGTGG + Intergenic
1072888907 10:99303983-99304005 CTCTGGATGCCTAATCTAAGGGG - Intergenic
1074823694 10:117199873-117199895 CTCTGGGTCCCAAAGCCCACTGG + Intronic
1075961604 10:126571824-126571846 CACTGGCTACCAAACCTCAAGGG + Intronic
1077248223 11:1549266-1549288 CTGTGGGGACCAGAGCTCAGAGG - Intergenic
1078766015 11:14299284-14299306 GTTTGGATACCAAATCCCAGAGG - Intronic
1080491985 11:32775145-32775167 CACTGGCTCCCAAAGCTGAGTGG - Intronic
1081587060 11:44393336-44393358 ATCCTGATACCAAAGCTTAGAGG - Intergenic
1082792618 11:57357359-57357381 AACTGGATACCTGAGCTCAGGGG + Intronic
1082918229 11:58463033-58463055 CTTAGGATGCCAAAGCTCAGTGG - Intergenic
1083029833 11:59582372-59582394 CTCTGGATACCAAAGCTCAGTGG + Intronic
1083914937 11:65735792-65735814 CTCTGGATACCTGATCTAAGGGG + Intergenic
1084439612 11:69165115-69165137 CTCTGGACACCAAGGCTCCGGGG + Intergenic
1085897531 11:80657590-80657612 GTCTGGAGAACAAAGCTGAGAGG + Intergenic
1086561826 11:88177153-88177175 ATGTGGAAACCAAGGCTCAGAGG - Intergenic
1087158648 11:94928097-94928119 CTCTGTAAACCAAATCACAGAGG - Intergenic
1088498519 11:110457965-110457987 CTTTGGACACCAAAGCAGAGTGG + Intronic
1088608672 11:111556326-111556348 CTCTGGACACGAAAGCTCTGTGG - Intronic
1089024530 11:115255352-115255374 CACTGCATAGCAAAGCTCTGAGG - Intronic
1089060382 11:115621518-115621540 TCCTGGAAACCAAAGCCCAGAGG + Intergenic
1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG + Intergenic
1089663916 11:120004838-120004860 CTCTGGGCGCCAAAACTCAGTGG - Intergenic
1091348374 11:134871816-134871838 CTCTGGACACCAAGGCTTAGTGG - Intergenic
1091918238 12:4284406-4284428 CTCTGGAGAACACAGCTCACTGG - Intronic
1093031140 12:14289631-14289653 CTCTGAATACTGGAGCTCAGTGG - Intergenic
1095930041 12:47616222-47616244 CTCTAGATCCCTGAGCTCAGAGG - Intergenic
1098066216 12:66620052-66620074 ATATGGAGATCAAAGCTCAGAGG + Intronic
1098332312 12:69366458-69366480 ATCAGGATACCAAGGCTCAGAGG + Intronic
1098881352 12:75920517-75920539 CTCTGGAAATGTAAGCTCAGTGG + Intergenic
1099781665 12:87202982-87203004 CTCTGGCTACCACAGCTGGGAGG - Intergenic
1100380160 12:94054395-94054417 CACTGGACACCAAGGCTCAGTGG + Intergenic
1104186573 12:126438355-126438377 GTGTGGAAACTAAAGCTCAGAGG + Intergenic
1104644723 12:130488787-130488809 CTCTGCAGACCAAAGCCCAGGGG - Intronic
1104888961 12:132130597-132130619 ATGTGGAAAGCAAAGCTCAGGGG + Intronic
1106080542 13:26496957-26496979 CTCTGGTCACCAAAGCAAAGAGG + Intergenic
1106607315 13:31241249-31241271 CTCGGGCTTCCCAAGCTCAGGGG + Intronic
1106660098 13:31790633-31790655 CTCTGGTTCCCAAAGCTAAATGG - Intronic
1106696271 13:32177166-32177188 GTCTAGATACCAAAGTTCAGGGG - Intronic
1107596760 13:41971317-41971339 CTCTGGATGCCAAAGCTCAGTGG + Intergenic
1108377614 13:49828122-49828144 CTCTGGATACCTGACCTAAGAGG - Intergenic
1108497522 13:51040195-51040217 CTTTGGATACCAACGCTTTGGGG - Intergenic
1111430778 13:88145973-88145995 CTCTGGATACCTGATCTAAGGGG + Intergenic
1112484245 13:99805551-99805573 CTCAGGATACTAAAGCTGGGAGG + Intronic
1113239920 13:108326118-108326140 TTATGGATAAGAAAGCTCAGGGG - Intergenic
1114852695 14:26400197-26400219 CTTTGGATACCCAGGGTCAGAGG + Intergenic
1115002355 14:28438488-28438510 CTCTGGATACCTGATCTAAGGGG + Intergenic
1115734734 14:36313098-36313120 CTCTAGATATAAAAGCTAAGTGG - Intronic
1116666436 14:47781602-47781624 CTCTGGAAACTAAAGTTCTGAGG - Intergenic
1119574076 14:75702633-75702655 CCCTGGATGCCGAATCTCAGTGG + Intronic
1120281841 14:82448897-82448919 ATCTTTATACCAAATCTCAGGGG - Intergenic
1120414553 14:84202903-84202925 ATCTGGAGACCAAATCCCAGAGG - Intergenic
1121313070 14:92945616-92945638 CTGGGGACACCAAGGCTCAGTGG - Intronic
1123079063 14:105682938-105682960 CTTTGGGTACCACGGCTCAGGGG - Intergenic
1124376231 15:29130661-29130683 CTCTGGAAACCAAATCTGACCGG - Intronic
1125126381 15:36227052-36227074 CTCGGGATACCAGAGGGCAGAGG + Intergenic
1125757943 15:42077716-42077738 CTCTGGATACCTGATCTAAGGGG - Intronic
1127747336 15:61992724-61992746 CTGTGGATACCACAGCTCAGTGG + Intronic
1128283215 15:66414584-66414606 CTCTGGACACTGAAGCTCAGGGG - Intronic
1128925689 15:71653379-71653401 CTCTTTATTCCAAAGCTCATGGG - Intronic
1128991519 15:72264668-72264690 TCCTGGAGTCCAAAGCTCAGTGG + Intronic
1129637879 15:77341520-77341542 CTGTGAACACCAAAGCTCAGTGG - Intronic
1130764895 15:86859940-86859962 CTCTGGCTAACAATCCTCAGTGG - Intronic
1131915254 15:97258087-97258109 CTCTGGACACAAAATCTCTGTGG - Intergenic
1135272034 16:21077816-21077838 GTCAGGAAACCAACGCTCAGAGG + Intronic
1143076020 17:4343958-4343980 CTCTGGAGACTAAAGCTCTGGGG + Intronic
1143564411 17:7712713-7712735 CTCTGGATGCCAGCGCTCTGAGG - Intergenic
1144200096 17:12933347-12933369 CTCTGGTTCCCAAAGATCTGGGG - Intronic
1144244585 17:13350180-13350202 CTCTGGAAACAAGAGCTCTGGGG + Intergenic
1144494795 17:15739285-15739307 CTGTGGCTCACAAAGCTCAGTGG + Intronic
1144874220 17:18388746-18388768 CTCTGAACACCACCGCTCAGGGG + Intronic
1144905458 17:18637387-18637409 CTGTGGCTCACAAAGCTCAGTGG - Intronic
1145776879 17:27535226-27535248 CACTGCAAACCAAGGCTCAGGGG - Intronic
1146595394 17:34163918-34163940 CGCTGGTCACCAAAGATCAGAGG - Intronic
1146613233 17:34326997-34327019 CTATGGATACTAAAACTCATGGG + Intergenic
1147664119 17:42134932-42134954 CTCTGGACACTACAGGTCAGTGG + Intronic
1151498869 17:74476060-74476082 CTCTGGACACCAAAGCTTGGAGG - Intronic
1151500648 17:74486172-74486194 CTCTGCATACCAAAGGACACTGG + Intergenic
1152003605 17:77662943-77662965 CTCTAGATCCCATAGATCAGGGG + Intergenic
1153181630 18:2441676-2441698 CTCTGGAAACCGAAGCTCAGTGG - Intergenic
1155276052 18:24188402-24188424 CTCTGGAGACCAAGGCACAAAGG + Intronic
1156508545 18:37615576-37615598 CTCTGGATAACAAATTGCAGAGG - Intergenic
1156563808 18:38160519-38160541 ATTTGGATAACAAACCTCAGAGG + Intergenic
1157046053 18:44103105-44103127 CTCTGGATACCTGATCTAAGGGG + Intergenic
1159275940 18:66221711-66221733 CTCTGGACTCCAAAGCTTAGGGG - Intergenic
1161052045 19:2169250-2169272 CTCAGGACACTCAAGCTCAGAGG - Intronic
1161523656 19:4739767-4739789 CTCTGGACCCCAAAGCTTGGTGG + Intergenic
1164788924 19:30959603-30959625 CTCTGGAGATCAAAGCCCTGGGG - Intergenic
1166822811 19:45591050-45591072 TTCTGCATACCACAGCTCACTGG - Exonic
1167751240 19:51381481-51381503 CTCTGGACACTGAAGCTCAGTGG + Intronic
1168319165 19:55499048-55499070 CTCTGGATGCCAAGGCTTGGGGG - Intronic
925814319 2:7732787-7732809 CGCTGGACACCAAAGCTCAGGGG - Intergenic
926259065 2:11240072-11240094 CTCTGGATACTGACACTCAGTGG - Intronic
927732164 2:25483145-25483167 CTCTGGTACCCACAGCTCAGTGG - Intronic
928832584 2:35505807-35505829 TTCTGGATACCAAAACTTAGTGG + Intergenic
929028421 2:37627776-37627798 TTCTGGAGAACAAAGCTCACTGG - Intergenic
929813209 2:45209219-45209241 CTCTGGATCCCACAGCAGAGTGG + Intergenic
931075919 2:58711278-58711300 CTGAGGTCACCAAAGCTCAGAGG - Intergenic
932390731 2:71388742-71388764 CTCGGGATATCCAAGTTCAGGGG + Intronic
933821709 2:86118417-86118439 CTCTGCTTCCCAAAGCTCACAGG + Intronic
934507644 2:94906779-94906801 CTCTGGATGGCAAAGCTCCTGGG + Intergenic
936054273 2:109249378-109249400 ATGAGGAAACCAAAGCTCAGAGG + Intronic
936229481 2:110687512-110687534 CTCTGAACACCAAAGCTCAGTGG - Intergenic
936343711 2:111659431-111659453 TTCTGAATAACAAAGCACAGTGG - Intergenic
937156226 2:119721292-119721314 CTCTGGATGTTGAAGCTCAGTGG + Intergenic
937888787 2:126919220-126919242 CTCTGGATACCGAGGCTCAGTGG - Intergenic
937920627 2:127127030-127127052 GTCTGGACACTGAAGCTCAGTGG + Intergenic
944481434 2:200161428-200161450 CTCTGGACACTGAAGCTCAGCGG - Intergenic
945273206 2:207962300-207962322 CTCAGGACACTGAAGCTCAGAGG + Intronic
947697607 2:232205044-232205066 CTCTTGACAGCAAAACTCAGAGG - Intronic
948260019 2:236596936-236596958 ATGTGGAAACCAAAGCTCCGAGG - Intergenic
948900528 2:240954609-240954631 CTCTGGACACCAAAATGCAGTGG - Intronic
1170471584 20:16673411-16673433 TTCTAGATACCAATGCTCTGAGG + Intergenic
1171895201 20:30752113-30752135 CTCTGGATGGCAAAGCTCCCGGG + Intergenic
1173306195 20:41852363-41852385 CTGTAGACACCAAAGCTAAGAGG - Intergenic
1174389610 20:50210046-50210068 CTCAGCTTCCCAAAGCTCAGGGG + Intergenic
1175208756 20:57333491-57333513 CTATGGATAGCAAAACTGAGAGG - Intronic
1176606647 21:8839549-8839571 CTCTGGATGGCAAAGCTCCCGGG - Intergenic
1176843740 21:13860646-13860668 TTCTGGACAGCAAAGCTCAAGGG - Intergenic
1177127142 21:17209207-17209229 CTCTGAATGCCGAAGTTCAGGGG - Intergenic
1177443780 21:21165290-21165312 TTCTGGACACCCAAGCTCAGAGG - Intronic
1178253756 21:31031489-31031511 GTTGGGAAACCAAAGCTCAGAGG - Intergenic
1180356721 22:11849251-11849273 CTCTGGATGGCAAAGCTCCCGGG - Intergenic
1180381540 22:12143080-12143102 CTCTGGATGGCAAAGCTCCCGGG + Intergenic
1180937796 22:19637547-19637569 CTCTGCTTAGCACAGCTCAGGGG - Intergenic
1182244992 22:28949899-28949921 TGCTGCATACCAAAGCACAGTGG - Intronic
1182321794 22:29482467-29482489 GTGTGGCTACCAATGCTCAGGGG + Intronic
1183723419 22:39575137-39575159 CTCTGGATTCGAAATGTCAGGGG + Intronic
949100165 3:133738-133760 CCCTGGACACCAAAGCTTACTGG - Intergenic
949792782 3:7811605-7811627 CTCTGGACACTAAAGCTCAAGGG + Intergenic
950140693 3:10613125-10613147 CTCTGGACACCAAAGCTCAGTGG + Intronic
950631967 3:14287818-14287840 TTCTGGAACCCACAGCTCAGAGG + Intergenic
953422163 3:42762538-42762560 CCCTGGACACCAAGACTCAGGGG + Intronic
956391107 3:68773419-68773441 CTTTGGACACCAAAGCTTGGTGG - Intronic
956806704 3:72821369-72821391 CTCATGAAACCAGAGCTCAGGGG + Intronic
958595396 3:96216102-96216124 CTCTGTATACCTAATCTAAGGGG + Intergenic
960510612 3:118544729-118544751 CTGTGGATACTCAAGGTCAGAGG + Intergenic
962841443 3:139236370-139236392 ATAGGGATACCAAGGCTCAGAGG + Intronic
963135548 3:141900335-141900357 CTCTGGACACTGAAGTTCAGTGG + Intronic
963840488 3:150100001-150100023 CTTTAGATACCAGAGATCAGTGG + Intergenic
964352313 3:155815361-155815383 CTGTGGACACCAAAGCTTGGGGG + Intergenic
964776700 3:160287096-160287118 TTCTGAACGCCAAAGCTCAGCGG + Intronic
964915177 3:161832206-161832228 CTCTGGACACTGAAGCTCAGTGG - Intergenic
965138671 3:164807396-164807418 ATCTGTATCCCAAACCTCAGAGG + Intergenic
965261306 3:166489492-166489514 CTTTGGATACCAAAGAGCATAGG + Intergenic
965408825 3:168304167-168304189 CTCTGGACACTGAGGCTCAGCGG - Intergenic
965686959 3:171314339-171314361 CTCTTGAGACCACTGCTCAGAGG - Intronic
966887266 3:184383563-184383585 CACTGGAGACCAAGCCTCAGCGG + Exonic
972116765 4:35645483-35645505 GTCAGGAAACCAAGGCTCAGAGG - Intergenic
972528216 4:39937067-39937089 CTGTGAACACTAAAGCTCAGGGG - Intronic
972661871 4:41124054-41124076 CACTGTATATCAAAGCTCTGTGG - Intronic
973371465 4:49251608-49251630 CTCTGGATGGCAAAGCTCCCGGG + Intergenic
973389543 4:49543703-49543725 CTCTGGATGGCAAAGCTCCCGGG - Intergenic
974673285 4:65058473-65058495 TTCTGGATACCCACACTCAGTGG - Intergenic
975456709 4:74599510-74599532 ATCTGTATACCAAACCTCTGTGG - Intergenic
976530054 4:86141359-86141381 CTCAGGTTAAAAAAGCTCAGGGG - Intronic
976630129 4:87228039-87228061 CTCTGGATTCCAAAGCTTGGTGG + Intronic
976783409 4:88787853-88787875 CTCTGGAGGTCAAAGTTCAGAGG - Exonic
977772440 4:100875711-100875733 CTCTGGACACTGAAGTTCAGTGG - Intronic
978152494 4:105453800-105453822 CTGGGGATACAAATGCTCAGGGG - Intronic
980049026 4:128020494-128020516 CTCTGGACTGCAAGGCTCAGGGG - Intronic
981295489 4:143126340-143126362 CTCTAGACACTGAAGCTCAGTGG - Intergenic
981520095 4:145652232-145652254 CTTGGGACACTAAAGCTCAGGGG - Intronic
983712942 4:170742323-170742345 TTCTGGATACCAAAGTTCGGTGG - Intergenic
985290791 4:188384886-188384908 CTGTTGCTACCAAAGCACAGGGG - Intergenic
985960365 5:3298064-3298086 CTCTGGATACACAAGTTCACGGG + Intergenic
986307569 5:6527048-6527070 CACTGAATACCACATCTCAGCGG - Intergenic
986424145 5:7613584-7613606 CTTTGCACACCAAAGCTCAGTGG - Intronic
988207426 5:28157984-28158006 CTTTGGATACAGAACCTCAGGGG + Intergenic
989807690 5:45630607-45630629 CTCTGTATACCTAAGCTATGAGG + Intronic
990703752 5:58503628-58503650 CCATGGAAACCAAAGCTCGGTGG + Intergenic
991500561 5:67272559-67272581 CACTGGATAACAAAGTTAAGAGG - Intergenic
992717525 5:79525814-79525836 CTCTGGATGCTGAGGCTCAGGGG + Intergenic
993396120 5:87391118-87391140 GTCTGTACACCAAGGCTCAGAGG - Intronic
996144373 5:119955627-119955649 CTCTGGATGCTGAAGCTCAGTGG + Intergenic
997775301 5:136599046-136599068 CTCTAGACAACAAGGCTCAGTGG - Intergenic
998838184 5:146224809-146224831 CTCTGCCTCCCAAAGCTCTGGGG + Intronic
999054737 5:148562289-148562311 CTCTGGTTACAAAAGAGCAGGGG - Intronic
999262484 5:150246269-150246291 CTCTGGATCCCGAAGCTGACAGG + Intronic
1000262608 5:159602399-159602421 CTCTGGAAACCAAGGCTCAAAGG - Intergenic
1000391586 5:160728427-160728449 CTCTGGATACCATGGCTCAAGGG + Intronic
1000659026 5:163916305-163916327 CTCTGGCTACCAAGCCTGAGTGG + Intergenic
1001719870 5:173848090-173848112 CTCTGAAGACCCAAACTCAGGGG + Intergenic
1001923851 5:175621995-175622017 CTCTGGACACCAAGGCTTGGTGG - Intergenic
1003168097 6:3698997-3699019 CTCTAGACACCAAAGCTCATTGG + Intergenic
1003778840 6:9399380-9399402 CACTGCAGACCAAATCTCAGAGG + Intergenic
1003818225 6:9865326-9865348 TTCTGGGTCCCAAAGCTCTGAGG - Intronic
1006576167 6:35048081-35048103 CTCTGGAAGCCAGAGCTCCGTGG + Intronic
1007391584 6:41552485-41552507 CTCTGGGAAAGAAAGCTCAGAGG - Intronic
1007792726 6:44321624-44321646 CTCTGAAAACCACCGCTCAGAGG - Intronic
1007867390 6:44987463-44987485 CTCTGGATATCAGCTCTCAGTGG - Intronic
1009529333 6:64790268-64790290 CTATGAATACCAAACATCAGCGG + Intronic
1015090493 6:129351070-129351092 CCATGAATACCAAAGCTCACTGG - Intronic
1016036826 6:139391874-139391896 CTCTAGATAGCTAATCTCAGGGG - Intergenic
1017631732 6:156402485-156402507 CTCTGGCTACCAGAGCTGTGAGG - Intergenic
1017781462 6:157718820-157718842 CTCTGCAAACCAAGGCTCTGAGG - Intronic
1017999889 6:159569746-159569768 CTCTGGACACTGAAGCTCAGTGG - Intergenic
1018824454 6:167398654-167398676 CCCTGGATCCCAAGGCTCGGGGG + Intergenic
1020154702 7:5713214-5713236 CTCTGGAAAGCAGAGCTGAGTGG + Intronic
1020401769 7:7786728-7786750 ATCTGGAAACCAGAGCACAGTGG - Intronic
1020613314 7:10427640-10427662 TCCTGGACACCAAGGCTCAGGGG - Intergenic
1024435735 7:49352920-49352942 CTCTGGATACCTGATCTAAGAGG + Intergenic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1026061420 7:67030091-67030113 CCCTGGACACTGAAGCTCAGTGG - Intronic
1026716930 7:72797343-72797365 CCCTGGACACTGAAGCTCAGTGG + Intronic
1028657559 7:93227812-93227834 CTCTGTATTCGAGAGCTCAGAGG - Intergenic
1028888304 7:95959108-95959130 CAGTGGGTACCAAGGCTCAGAGG + Intronic
1030213970 7:107024238-107024260 CTCTTGATTTCAAAGCTCAGTGG - Intergenic
1031591929 7:123604092-123604114 CTCTGGAAGAAAAAGCTCAGTGG + Exonic
1031641912 7:124174931-124174953 TTCTGAACATCAAAGCTCAGTGG - Intergenic
1032109426 7:129062887-129062909 CTCTGAACACCAAAGTTCAGTGG + Intergenic
1033774210 7:144588735-144588757 GTCTGGTTACAAATGCTCAGGGG - Intronic
1034213348 7:149383891-149383913 CTCTGGATGCCACAGCACAAGGG - Intergenic
1034282618 7:149864577-149864599 CTCTTGCCACCAAAACTCAGGGG - Exonic
1035549585 8:510128-510150 CTCTGGATGCTGAAGCTTAGTGG - Intronic
1035851974 8:2929425-2929447 CTCTGGAGGCCAAAGGTCATGGG + Intergenic
1039488741 8:37931777-37931799 CTCTGGACACCAAGGCTTAGGGG - Intergenic
1039883424 8:41641343-41641365 CTCTGGAGTCCAGATCTCAGAGG + Intergenic
1040430855 8:47340796-47340818 TTCTGGATACTAAAGCTCAGTGG + Intronic
1041905206 8:63025408-63025430 CTCTAGACACCAAAACTCACTGG + Intronic
1042869713 8:73387166-73387188 CTCTGGTTAGCAAGGCTCACTGG + Intergenic
1044082577 8:87903886-87903908 CCCTGCATGGCAAAGCTCAGGGG - Intergenic
1044915141 8:97105281-97105303 CTCTGGATACCTCATCTAAGTGG + Intronic
1048705623 8:137149855-137149877 CTCTGGATACTAAGACTTAGTGG + Intergenic
1051664587 9:19456791-19456813 CTTTGAAGACCAGAGCTCAGGGG + Intergenic
1053189389 9:36049198-36049220 CTCTGGACATAGAAGCTCAGTGG - Intronic
1054353450 9:64040654-64040676 CTCTGGATGGCAAAGCTCCCGGG - Intergenic
1055869342 9:80855377-80855399 CTCTGGATGGCAAAGCTCCAGGG - Intergenic
1060818519 9:126648484-126648506 CCCTGGGTACCACAGCTCACAGG - Intronic
1061793783 9:133071768-133071790 CTCTTGATACCAAGGCTCATGGG - Exonic
1203695902 Un_GL000214v1:96676-96698 CTCTGGATGGCAAAGCTCCGGGG + Intergenic
1203701972 Un_KI270742v1:4354-4376 CTCTGGATGGCAAAGCTCCCAGG - Intergenic
1203553954 Un_KI270743v1:190409-190431 CTCTGGATGGCAAAGCTCCTGGG - Intergenic
1203640371 Un_KI270751v1:7387-7409 CTCTGGATGGCAAAGCTCCGGGG - Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1187935773 X:24334516-24334538 TTCTGGACACCAAGGCTCAGGGG - Intergenic
1188903485 X:35763008-35763030 CTCGGGATACAAAAACACAGAGG - Intergenic
1189276951 X:39793612-39793634 CTCTTGAGAGCAAAGTTCAGTGG - Intergenic
1189315288 X:40051117-40051139 CTCTGGAAACCAAAGCAGACTGG - Intronic
1190246268 X:48692550-48692572 ATGCGGAAACCAAAGCTCAGAGG - Intergenic
1195559945 X:106271814-106271836 CTCTGGATGTCAACTCTCAGAGG + Intergenic
1195562017 X:106294525-106294547 CTCTGGATGTCAACTCTCAGAGG - Intergenic
1196007010 X:110847562-110847584 CTGTGTAAACGAAAGCTCAGTGG - Intergenic