ID: 1083032271

View in Genome Browser
Species Human (GRCh38)
Location 11:59604007-59604029
Sequence CTGTTTCTGAGTAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 314}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083032271_1083032275 2 Left 1083032271 11:59604007-59604029 CCATCCTCCTTACTCAGAAACAG 0: 1
1: 0
2: 2
3: 44
4: 314
Right 1083032275 11:59604032-59604054 CAGAGTGCATACTCTGGAGTTGG 0: 1
1: 0
2: 0
3: 27
4: 266
1083032271_1083032277 11 Left 1083032271 11:59604007-59604029 CCATCCTCCTTACTCAGAAACAG 0: 1
1: 0
2: 2
3: 44
4: 314
Right 1083032277 11:59604041-59604063 TACTCTGGAGTTGGACCGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 81
1083032271_1083032276 7 Left 1083032271 11:59604007-59604029 CCATCCTCCTTACTCAGAAACAG 0: 1
1: 0
2: 2
3: 44
4: 314
Right 1083032276 11:59604037-59604059 TGCATACTCTGGAGTTGGACCGG 0: 1
1: 0
2: 1
3: 14
4: 130
1083032271_1083032278 12 Left 1083032271 11:59604007-59604029 CCATCCTCCTTACTCAGAAACAG 0: 1
1: 0
2: 2
3: 44
4: 314
Right 1083032278 11:59604042-59604064 ACTCTGGAGTTGGACCGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1083032271_1083032274 -4 Left 1083032271 11:59604007-59604029 CCATCCTCCTTACTCAGAAACAG 0: 1
1: 0
2: 2
3: 44
4: 314
Right 1083032274 11:59604026-59604048 ACAGTACAGAGTGCATACTCTGG 0: 1
1: 0
2: 0
3: 2
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083032271 Original CRISPR CTGTTTCTGAGTAAGGAGGA TGG (reversed) Intronic
904560753 1:31395598-31395620 CTTTTTCTGAGTAGAGAGGAAGG + Intergenic
904988950 1:34576117-34576139 CTGTTGCTGAGGAAGGGGAATGG - Intergenic
905885585 1:41490077-41490099 TTGTTTCTCATGAAGGAGGATGG - Intergenic
906383619 1:45348371-45348393 GTGTTTCTGAGGAAGGAGGAAGG - Intronic
907354710 1:53862839-53862861 CTGTTTCTAAGTGAGGAGGCAGG + Intronic
911138525 1:94470118-94470140 CTTTTTCTGAGTAAGGATGAAGG + Intronic
912413749 1:109494503-109494525 CTGTTTCTGAGGAAGTAGTTCGG - Exonic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
915467125 1:156104317-156104339 CAGTTGCTAAGCAAGGAGGAAGG - Intronic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
917835101 1:178935359-178935381 CTGTCTCTAAGGAAGTAGGATGG + Intergenic
917845599 1:179017503-179017525 CTGTGTTTGCGTATGGAGGAAGG + Intergenic
919128080 1:193420864-193420886 CTGTTTATGATTAAGCTGGAAGG + Intergenic
920386826 1:205575516-205575538 CTGGTTCTGTGAAAAGAGGAGGG - Intronic
920502025 1:206491492-206491514 ATGTCTCTGGGAAAGGAGGAAGG - Exonic
920587079 1:207175763-207175785 CAGCTACTGAGTCAGGAGGATGG - Intergenic
921575694 1:216832214-216832236 CTGTTGCTGAGTAAAGATGAAGG - Intronic
923466171 1:234249334-234249356 CTCTTTCTCACTAGGGAGGATGG - Intronic
923507591 1:234619101-234619123 ACCTTTCTGAGTCAGGAGGAGGG - Intergenic
1062966639 10:1612199-1612221 CTTTTTCTGAGTTGTGAGGAGGG + Intronic
1064084924 10:12338298-12338320 GTGTTTCTGAAAAAGGAGGAAGG - Intergenic
1066784211 10:38984884-38984906 CTGTTTCAGAGAAAGAATGAAGG - Intergenic
1066983840 10:42445596-42445618 CTGTTTCAGAGAAAGAATGAAGG + Intergenic
1067371291 10:45685335-45685357 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067388492 10:45840816-45840838 CTGTTTCAGAGACAGGATGAAGG + Intronic
1067417573 10:46116143-46116165 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067445771 10:46343762-46343784 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067448001 10:46364729-46364751 CTGTATCTGGGAAAGGAGGCTGG - Intergenic
1067502988 10:46823031-46823053 CTGTTTCAGAGACAGGATGAAGG - Intergenic
1067589377 10:47496032-47496054 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067591608 10:47516980-47517002 CTGTTTCAGAGACAGGATGAAGG + Intronic
1067636503 10:48004111-48004133 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067638723 10:48025055-48025077 CTGTTTCAGAGACAGGATGAAGG + Intergenic
1067843359 10:49699577-49699599 CTGCTTCTGATCAAGGAGCATGG + Intronic
1067874761 10:49995250-49995272 CTGTTTCAGAGACAGGATGAAGG - Intronic
1068966144 10:62913854-62913876 CTGTTTCTGTTTAGGGAGAAGGG - Intronic
1069146611 10:64900098-64900120 TTGTTTCTGAATAAAGAGGCAGG - Intergenic
1069211312 10:65763095-65763117 CTTTCTCTGAGTAGGGAGGCAGG + Intergenic
1070007004 10:72434159-72434181 ATTTTTCTAAGTAAGGAAGATGG - Intronic
1070133051 10:73668095-73668117 CTGTATCCGGGAAAGGAGGATGG + Intergenic
1070135706 10:73691204-73691226 CTGTTTCAGAGACAGGATGAAGG + Intronic
1071777390 10:88804488-88804510 CTGGTTCTGAGGTAGGAGAAGGG + Intronic
1072225429 10:93364319-93364341 CTCCTTCTCAGTAATGAGGATGG + Intronic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1077549498 11:3193767-3193789 CTGCTTCTGAGAAAGGACGGTGG - Intergenic
1077577922 11:3398434-3398456 CTATTTCTCAGCAAGGAGGAAGG + Intergenic
1078844515 11:15109277-15109299 GTGTTTCTGAGTCAGTAGGTGGG - Intergenic
1081201978 11:40227526-40227548 TTGTTTCTGAGAGGGGAGGAGGG + Intronic
1081303044 11:41477024-41477046 CTGTTACAGAATGAGGAGGAGGG + Intergenic
1082183948 11:49156363-49156385 CTAATTTTGAATAAGGAGGAGGG + Intronic
1082757400 11:57091749-57091771 TTGTTGGTGAGGAAGGAGGAAGG - Intergenic
1083032271 11:59604007-59604029 CTGTTTCTGAGTAAGGAGGATGG - Intronic
1084231867 11:67759335-67759357 CTATTTCTCTGCAAGGAGGAAGG + Intergenic
1086682410 11:89689006-89689028 CTAATTTTGAATAAGGAGGAGGG - Intergenic
1090302145 11:125651709-125651731 CTGCTACTGAGTGAGGAGCAGGG + Intronic
1090859760 11:130642537-130642559 GTGTTTCTGAGTAAAGTGGATGG + Intergenic
1091127482 11:133114020-133114042 CTGTTTCTGAAGAAGCAGGGAGG - Intronic
1091864059 12:3815048-3815070 CTGTATCTGTGTGAAGAGGAAGG + Intronic
1092233903 12:6793568-6793590 AGGTTTCTGAAAAAGGAGGAAGG - Intronic
1093372894 12:18386064-18386086 TTGGTTCTGTGGAAGGAGGAGGG - Intronic
1095523780 12:43100439-43100461 CTGTTGTTGAGTAAGTATGAGGG + Intergenic
1098530347 12:71534643-71534665 CTGTTTCTGAGGAATGAGTGAGG - Intronic
1098898876 12:76092411-76092433 CTGATTCTGAGGTAGGAGGCAGG + Intergenic
1099453164 12:82832487-82832509 CAGTATCTGAGTGAGGAGCATGG + Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099847141 12:88042053-88042075 CTGTCTCACAGTAAGGAGTATGG + Intronic
1101156952 12:101936640-101936662 CTGTCTCTGAGAAAGGAACAGGG + Intronic
1103058103 12:117837264-117837286 CTGAGTCTGAGAGAGGAGGAGGG - Intronic
1103338991 12:120211183-120211205 CTGTTTCTGTGGGAGGAGAAGGG - Exonic
1107452640 13:40524689-40524711 CTGATTATGAGTAATGAGAAAGG - Intergenic
1107518019 13:41150498-41150520 CTGCTGCTGAGAGAGGAGGAAGG - Intergenic
1108808115 13:54185322-54185344 CTTGTTCTTAGTAAGCAGGATGG + Intergenic
1110777072 13:79420050-79420072 CTATCACTGAGTAAGGAAGAGGG + Intergenic
1111474571 13:88727429-88727451 CTGTTTCTGAGTTAGGTGCTGGG + Intergenic
1112746743 13:102535536-102535558 CTGATTCTGAGGAAGGATGAAGG - Intergenic
1113542293 13:111118245-111118267 CTGTTTCAGAGTTAGGAAGAGGG + Intronic
1114261551 14:21040399-21040421 ATGATTCTAAGTCAGGAGGATGG - Intronic
1114390647 14:22304301-22304323 CTGTTCCTGAGCATGCAGGAGGG + Intergenic
1115013303 14:28577325-28577347 GTGTATCTGAGTATAGAGGAAGG - Intergenic
1115724741 14:36200840-36200862 CTGTTTCTGATTAATAAAGAAGG + Intergenic
1115872807 14:37824226-37824248 TTGTTTGTAAGTGAGGAGGAAGG - Intronic
1116644842 14:47514146-47514168 TTGTTTTTGAGAAAGGTGGAGGG + Intronic
1117200718 14:53387187-53387209 CTGATTCTGATTTAGGAGGTCGG + Intergenic
1117777813 14:59200280-59200302 CTATCTGTGGGTAAGGAGGATGG + Intronic
1117839640 14:59846287-59846309 CTGTAGGTGAGCAAGGAGGAGGG - Intronic
1118350041 14:64967186-64967208 CTCCTTCTGGGTGAGGAGGAGGG - Intronic
1118722576 14:68604714-68604736 CTGCTCCTCAGTGAGGAGGAGGG - Intronic
1119607939 14:76036830-76036852 CTGTTTCTAAAAAAGAAGGAGGG - Intronic
1122882145 14:104694990-104695012 CTTTTTCTGAGGACAGAGGAGGG + Intronic
1124883174 15:33660576-33660598 CTGTTTCTGAGTAATGAAAGTGG - Intronic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1126526861 15:49665925-49665947 CTGTTTCTCAGTGAGTAGAAAGG + Intergenic
1130717707 15:86352092-86352114 CTGTTTCTGAGTAGCTAGGCTGG + Intronic
1131650719 15:94395824-94395846 CTGTTTCTGAGTAATGATTCAGG - Intronic
1131965331 15:97835923-97835945 GTGTTTTTGAGTGCGGAGGATGG - Intergenic
1132415161 15:101614189-101614211 CTGCTCCTGGGGAAGGAGGAAGG - Intergenic
1132782783 16:1637323-1637345 CTCTTACTGAGGAAGGAGAATGG + Intronic
1133534846 16:6691905-6691927 CTGGTTTTGAATATGGAGGAAGG + Intronic
1134230019 16:12421720-12421742 ATGCTTCTGATTGAGGAGGAAGG - Intronic
1134490384 16:14691661-14691683 TTGTCACTGTGTAAGGAGGAAGG - Intronic
1134495765 16:14730778-14730800 TTGTCACTGTGTAAGGAGGAAGG - Intronic
1134501309 16:14771089-14771111 TTGTTACTGTGTAAGGAGGAAGG - Intronic
1134579272 16:15357945-15357967 TTGTTACTGTGTAAGGAGGAAGG + Intergenic
1134723310 16:16399609-16399631 TTGTTACTGTGTAAGGAGGAAGG - Intergenic
1134849048 16:17465668-17465690 CTGTTTCTGTGTGAGCAGGACGG - Intronic
1134944118 16:18312261-18312283 TTGTTACTGTGTAAGGAGGAAGG + Intergenic
1136121490 16:28138606-28138628 CTCTTGCTGAGGAAGGAGAATGG - Intronic
1136165541 16:28450609-28450631 TTGTTACTGTGTAAGGAGGAAGG + Intergenic
1136197431 16:28664400-28664422 TTGTTACTGTGTAAGGAGGAAGG - Intergenic
1136213770 16:28778547-28778569 TTGTTACTGTGTAAGGAGGAAGG - Intergenic
1136258505 16:29058471-29058493 TTGTTACTGTGTAAGGAGGAAGG - Intergenic
1136319990 16:29477845-29477867 TTGTTACTGTGTAAGGAGGAAGG + Intergenic
1136392472 16:29974185-29974207 GGGTATCTGAGAAAGGAGGAGGG - Exonic
1136434561 16:30217186-30217208 TTGTTACTGTGTAAGGAGGAAGG + Intergenic
1136575993 16:31125728-31125750 CTGTAGCTGAGAAGGGAGGAAGG - Intronic
1137335828 16:47547716-47547738 CTGTTTATGGGTACTGAGGATGG - Intronic
1138130539 16:54475731-54475753 GTGTTTCTAAGTAAGGAGGCCGG - Intergenic
1140156412 16:72432139-72432161 CTTTTTCAGAGTATAGAGGAGGG - Intergenic
1140850372 16:78929882-78929904 CTGCTTCTAAGAAAGAAGGATGG - Intronic
1143905468 17:10205611-10205633 ATGATTCTGAGAGAGGAGGAAGG + Intergenic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144131716 17:12252965-12252987 CTGATTCTGAGTGAGTACGAGGG + Intergenic
1144439860 17:15271893-15271915 GTGATTCTGAGTAAGGAGCTGGG + Intergenic
1144658981 17:17056222-17056244 CTGTTTCTGAATGGGAAGGACGG + Intronic
1144673297 17:17145165-17145187 CTGTCTCTGAGGAGTGAGGAAGG - Intronic
1145275512 17:21427023-21427045 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1145711811 17:26984873-26984895 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146903680 17:36604099-36604121 GTGTCTCTGAGTACGCAGGAAGG - Intronic
1149025970 17:52027701-52027723 CTGATTCTGAGTAGGGGTGAGGG - Intronic
1149220040 17:54406544-54406566 CTTTTACTGAGTTAGGAGAAGGG - Intergenic
1149389369 17:56173986-56174008 CTGTATCAGAGAAAGGAGGCAGG - Intronic
1151255830 17:72875762-72875784 CTCCTTCTGAGGAAGGAGGTGGG + Intronic
1152636956 17:81434146-81434168 CTGCTTCTGAGCCAGGAGGATGG + Intronic
1155093815 18:22536660-22536682 CTGTTCCTGTGCAAGAAGGAGGG + Intergenic
1155112537 18:22730299-22730321 CTGTTTCTGAGGATTTAGGAGGG - Intergenic
1155147125 18:23093557-23093579 CTATTTGGGAGTAAGGAGGGAGG - Intergenic
1155211080 18:23602421-23602443 GTGATACTGAGTAAGGTGGAAGG - Intronic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1155796547 18:30044698-30044720 ATGTTTATGAGTAAGAAGCAAGG - Intergenic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156399555 18:36728194-36728216 CTGTTGCTGAGTGGGGAAGAGGG + Intronic
1157273332 18:46293312-46293334 CTGTTTCTAAGCCAGGCGGAAGG - Intergenic
1157274755 18:46302635-46302657 TTGTTTCTGTTCAAGGAGGAGGG - Intergenic
1157898395 18:51490147-51490169 CTGCTTTGGAGTCAGGAGGAGGG - Intergenic
1158509445 18:58077597-58077619 TAGTTTCTGAGTTAGAAGGATGG + Intronic
1159758272 18:72392657-72392679 CTCTTTCTATGTAAGGAGAATGG - Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1160689856 19:456486-456508 GTGTTGCTGAGGGAGGAGGAGGG - Intronic
1161330095 19:3682845-3682867 CAGTTTCTGAGTCAGGAGTCTGG - Intronic
1161722316 19:5909989-5910011 CAGTTCCTGAGTGAGGAGGTAGG - Exonic
1161958257 19:7508048-7508070 CAGTGTCTGACCAAGGAGGATGG - Intronic
1162452206 19:10761996-10762018 CTGTTTCTCATTGAGCAGGATGG + Intronic
1163462325 19:17446613-17446635 AGGGTTGTGAGTAAGGAGGAAGG - Intronic
1163783079 19:19260763-19260785 TTGCTTCTGAGGAAGGAGGGGGG - Intronic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166351255 19:42199466-42199488 CTGTTGCTGATGGAGGAGGAAGG - Exonic
1166569536 19:43784894-43784916 CTGGTTCTGAGGGAGGAGGGGGG + Intergenic
1166975447 19:46602580-46602602 TTCTTCCTGAGGAAGGAGGACGG - Intronic
1167386839 19:49168468-49168490 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167741036 19:51325232-51325254 CTGGGTCTGAGGGAGGAGGAGGG + Intronic
1167752122 19:51387615-51387637 CTGGGTCTGAGGGAGGAGGATGG + Intronic
1168077687 19:53990392-53990414 CTGGGTCTGAGGGAGGAGGAGGG - Intergenic
1168155763 19:54472511-54472533 CTGGGTCTGAGGGAGGAGGAAGG - Intronic
1168222987 19:54974483-54974505 CTGCTTCTGAAAAAGGAGAAGGG - Exonic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
928596644 2:32865270-32865292 CTGTTTCTAAGAAAAGGGGAGGG + Intergenic
928661064 2:33502282-33502304 CTGTTTCTGTGTGTGGAGGTGGG + Intronic
929624761 2:43395233-43395255 CTGTATCTGAGTTAGAAGGAAGG - Intronic
931848665 2:66231043-66231065 CTGTTTGTGGGTCAAGAGGAAGG + Intergenic
931905690 2:66840604-66840626 CTGGTTTTCAGTAAGGAAGAAGG + Intergenic
933852597 2:86382608-86382630 CAGTTTCTGAGCTGGGAGGAGGG - Intergenic
933939930 2:87236546-87236568 ATTTTTCGGAGTAAGGAGGTGGG + Intergenic
934017908 2:87908839-87908861 CTGTTTCTGACTGAGAAGTAGGG + Intergenic
934158008 2:89221240-89221262 GTGACTCTGAGGAAGGAGGAAGG + Intergenic
934209257 2:89961184-89961206 GTGACTCTGAGGAAGGAGGAAGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934813470 2:97304466-97304488 CTATTCCTCAGTGAGGAGGAGGG + Intergenic
934824225 2:97404014-97404036 CTATTCCTCAGTGAGGAGGAGGG - Intergenic
935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG + Intergenic
936353208 2:111729229-111729251 ATTTTTCGGAGTAAGGAGGTGGG - Intergenic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
937839408 2:126510829-126510851 CTGTGACTGAGGAAAGAGGAAGG - Intergenic
938051744 2:128179304-128179326 TGTTTTCTGAGTAAGGAGGCCGG + Intronic
938321557 2:130369748-130369770 CTTTATCTGAGTAAGGGGGGTGG - Exonic
938960625 2:136337431-136337453 TTGTTTCTGAGGAAATAGGAAGG - Intergenic
940261013 2:151779825-151779847 CTGGCTCTGAGTAAGAAGGTGGG - Intergenic
940359591 2:152782987-152783009 CTACTTCTGGATAAGGAGGAAGG - Intergenic
940581757 2:155588710-155588732 CTGTTTCTGGATAATGAGGTAGG + Intergenic
940626519 2:156182079-156182101 CTGTTTCTGAACAAGGAAAATGG + Intergenic
942932784 2:181515791-181515813 CTGTTTCTGAGAAAGGAGAGAGG - Intronic
943613110 2:190058096-190058118 GTTTTCCTGAGTGAGGAGGATGG - Intronic
944447857 2:199809644-199809666 CTGTTTTTGAGCAAAGAGAAGGG - Intronic
948398152 2:237662729-237662751 CTGCTTCTGAGGTAGGAGGCGGG + Intronic
948857077 2:240735219-240735241 CTGGGTCTGAGAAAGGAGGAAGG - Intronic
1169624528 20:7549431-7549453 CTGTTTCTGAGTATCTATGAAGG + Intergenic
1170108657 20:12780647-12780669 CTGTTCCTGCATAAGGATGATGG + Intergenic
1170835926 20:19884455-19884477 CTGTTGTTGAGTAAGGGGGCTGG + Intergenic
1172093353 20:32448590-32448612 CTGTGCCTGAGTGAGGTGGAGGG + Intronic
1172286713 20:33745849-33745871 CTGGGACTGAGTAAGTAGGAAGG + Intronic
1173557576 20:43977469-43977491 CGGTTTCTAAGTAAAGAAGATGG - Intronic
1173675714 20:44833419-44833441 GTATTTCTTAGTAAGGAAGATGG - Intergenic
1173817103 20:45996760-45996782 CTGTTGTGGAGAAAGGAGGAGGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174218051 20:48932298-48932320 TTGGTTGTGAGTAAAGAGGACGG + Intronic
1174666423 20:52262082-52262104 CTGACTCTGAGTATGGAGGTAGG + Intergenic
1174875517 20:54223035-54223057 CAGTTTGTGTGTAAGGAGTAGGG - Intronic
1177241804 21:18467695-18467717 GTGTGTCTGTGTAAAGAGGAAGG + Intronic
1177675295 21:24290169-24290191 ATATTTCTGAGGAAGGTGGAGGG - Intergenic
1178272552 21:31205269-31205291 CTGTTTCCGACTGAGGCGGAAGG + Intronic
1178378286 21:32086586-32086608 ATGTTTCTGAGGCAGGAGAATGG + Intergenic
1178422128 21:32451406-32451428 CTATTTCTCGGCAAGGAGGAAGG - Intronic
1178605940 21:34036627-34036649 TTGTTACTCAGGAAGGAGGATGG + Intergenic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1182051503 22:27316006-27316028 CTTTTTCTGAGCAAGTGGGAGGG - Intergenic
1182508185 22:30800401-30800423 CTGGTTGTGAGGGAGGAGGAAGG + Intronic
1184640845 22:45869197-45869219 CTGCTTCTGAGAACGGAGCACGG - Intergenic
949715947 3:6931509-6931531 AAGTTTCTGAGTCAGGAGGATGG - Intronic
949752387 3:7369349-7369371 CTCATGCTGAGTCAGGAGGAGGG + Intronic
950708194 3:14796766-14796788 ATGTTGCTGAGAAAGGAGGAGGG - Intergenic
950817881 3:15726115-15726137 TTGTGTCTGAGTGAAGAGGAAGG - Intronic
950932504 3:16804587-16804609 CTGATTCAGAGTAAGGAAGAAGG + Intronic
953843509 3:46408490-46408512 CTTTTTCTCAGCCAGGAGGAGGG + Exonic
953900659 3:46840254-46840276 CTGTCTCTGAGAAAGAAAGAAGG + Intergenic
955853012 3:63241259-63241281 CTGACTCTGAGTAAGGTGAAAGG + Intronic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
959007842 3:101040526-101040548 GTGTATCTGAGGAATGAGGAGGG - Intergenic
959243889 3:103837762-103837784 CTGTTTTTGAGTAAAGATCATGG + Intergenic
961123768 3:124397375-124397397 CTGTTTCTGAGGATGGCGTAAGG - Intronic
961193997 3:124986083-124986105 CAGTTTCTCTGTAAGGAGCAAGG + Intronic
961880581 3:130058751-130058773 CTATTTCTCGGCAAGGAGGAAGG + Intergenic
966570902 3:181441779-181441801 CTGCTGCTGAATGAGGAGGAGGG + Intergenic
966666127 3:182472929-182472951 CTGGTTTTGAGGATGGAGGAAGG - Intergenic
967083525 3:186072491-186072513 CTCTTTCTGAAAAAGGAGAATGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967705767 3:192648987-192649009 ATGTTATTGAGTATGGAGGAAGG + Intronic
969152332 4:5180164-5180186 CTGTCTCTGAGAAATGAGCAGGG - Intronic
970016352 4:11516803-11516825 CTGATTTTGAATATGGAGGAAGG - Intergenic
970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG + Intergenic
971133297 4:23837583-23837605 CTGTTTCCAAGTCAGCAGGATGG - Intronic
971145533 4:23972003-23972025 CTGTTTCTAAGTACAGAGGATGG - Intergenic
971934932 4:33135721-33135743 CTGCTTCTCAGTAGGGATGAAGG - Intergenic
974292168 4:59947411-59947433 CATTTTCTGGGGAAGGAGGAGGG - Intergenic
974590754 4:63944806-63944828 CTGTTTCTGTGTAAAGATAATGG + Intergenic
975280649 4:72558373-72558395 CTGGTTCTGAGGATGGAGGAAGG - Intronic
975664221 4:76718940-76718962 GGGTTTCTCATTAAGGAGGAAGG + Intronic
976913665 4:90342424-90342446 TACTTTCTGAGAAAGGAGGATGG - Intronic
978281462 4:107020870-107020892 CTGTTTCTGAAAGAGGAGGCAGG - Intronic
979483006 4:121239577-121239599 CTGTTCTTTAGAAAGGAGGATGG + Intergenic
979877414 4:125910752-125910774 CAATCTCTGAATAAGGAGGAGGG + Intergenic
983460281 4:168018107-168018129 TTGTTTCAGAGTAAGTAAGAGGG - Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
986201546 5:5583828-5583850 CGTTTTCTGAGTAAGAAGGTGGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987308810 5:16663259-16663281 CTGTTTCTGGGAAAGGAAAATGG + Intronic
987740145 5:21897107-21897129 ATGTTGCTCAGTAAGGAGAAAGG + Intronic
988297331 5:29382582-29382604 ATGTTACTGAGCAAGGAGGATGG + Intergenic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
989713992 5:44437764-44437786 CTAATTCTGAGTATGGAGTATGG + Intergenic
990468783 5:56094330-56094352 CTGTTTGTTGGTAAGGAGTAAGG - Intergenic
990491915 5:56310877-56310899 CTGTCCCTGAGAAACGAGGAGGG - Intergenic
992748396 5:79840555-79840577 CTGTTTCTCAGGGAGGAGGTTGG - Intergenic
992984715 5:82216227-82216249 CTGCTTCAGAGTAAAAAGGAAGG + Intronic
993101113 5:83541025-83541047 CTGTTTCTGTGCTAGGAGCAGGG - Exonic
993360159 5:86965017-86965039 CTCTTTCCGAGAAAGGAGGCTGG - Intergenic
995499006 5:112782411-112782433 CTGTTTTGGAGTATGGTGGAAGG + Intronic
995605015 5:113844883-113844905 CTATTTCAGAATAAGCAGGATGG - Intergenic
997234316 5:132263970-132263992 CTGTATCTCAGTCTGGAGGAGGG - Intronic
997312231 5:132896634-132896656 GAGTTTGTGAGGAAGGAGGAAGG + Exonic
997606220 5:135177338-135177360 ATGTTTCAGAGTAAAGAGAAGGG - Intronic
1000829694 5:166087327-166087349 CTGTTTTTCAGGCAGGAGGAAGG + Intergenic
1001592955 5:172878845-172878867 GTGGTTCTCAGTAAGGTGGAGGG + Intronic
1001774465 5:174318159-174318181 CTGTTTCTGCTTAAGGATCATGG + Intergenic
1001840772 5:174874752-174874774 CTGTTGCGGAGTCAGGAAGAGGG - Intergenic
1002025572 5:176394320-176394342 CTGATTCTGATTCAGCAGGACGG - Intronic
1002286645 5:178166872-178166894 CTGTTTCTGTGAAGAGAGGATGG - Intergenic
1002307722 5:178293642-178293664 CTTTTGCTGAGTAAGAATGAGGG + Intronic
1002369784 5:178742477-178742499 ATGTTTGTGAGTAAGAAGCAAGG + Intergenic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004349534 6:14878994-14879016 CAGTTTCTCAGGAATGAGGAAGG + Intergenic
1005430783 6:25754514-25754536 TTGATTCTGATTAAGGATGAGGG + Intergenic
1006164313 6:32055824-32055846 GTGTTTGTGAGTGAGGAAGATGG - Intronic
1006425818 6:33962330-33962352 CTGTGTCTGAGAAGGAAGGAAGG - Intergenic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1009274713 6:61660900-61660922 GTTTTTCACAGTAAGGAGGATGG - Intergenic
1009809841 6:68646679-68646701 TTGTTTTTGGGTAAGGAGAATGG + Intronic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1011232731 6:85181003-85181025 CTATTGCTGAGGAAGGAGAAGGG - Intergenic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1015510152 6:134030413-134030435 CTCATTCTGAGTAAGGAGAAAGG + Intronic
1015606975 6:134967997-134968019 CTGTTTCTCTGTTAGGAGGAAGG - Intronic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1016330651 6:142948706-142948728 TTGTTTCAGAGTCATGAGGATGG + Intergenic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017454716 6:154591102-154591124 TTGTTTCTGAGTGAGGAGGTGGG + Intergenic
1018475859 6:164140840-164140862 CAGAATCTTAGTAAGGAGGATGG + Intergenic
1018889108 6:167968997-167969019 CCTTTACTGAGTAAGTAGGAAGG - Intronic
1019971980 7:4548797-4548819 GTGATTCTTAGTAAGGAGGTGGG - Intergenic
1020169075 7:5831274-5831296 CTGTTACTGTGTAAGGAGCAGGG + Intergenic
1020315607 7:6903440-6903462 CTATTTCTCGGCAAGGAGGAAGG + Intergenic
1021091833 7:16492722-16492744 CTGTTACTCAGTAAGTAGGATGG + Intronic
1022760350 7:33343007-33343029 TTGCTTCTCAGTAAGGAAGATGG - Intronic
1023733192 7:43211227-43211249 CTGTCTCTCAGTATGGAGGCAGG + Intronic
1024016697 7:45323526-45323548 CAGTTTATGGGTAAAGAGGAAGG + Intergenic
1024345174 7:48306047-48306069 CTGTTTGAGAGTAGGTAGGAGGG - Intronic
1024736902 7:52315075-52315097 CAGTTTCTGAGTAAGTGGCAAGG + Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025831474 7:65054889-65054911 CTAATTCTCAGGAAGGAGGAAGG - Intergenic
1025918610 7:65888780-65888802 CTAATTCTCAGGAAGGAGGAAGG - Intronic
1026141284 7:67709131-67709153 CTGCTTCTGAGAGAGGAGAAAGG + Intergenic
1027342520 7:77224321-77224343 CTGTTGCTGACTATGGAGGAAGG - Intronic
1027419730 7:78007162-78007184 CTGTTTCTCAGCATGGATGATGG + Intergenic
1028869728 7:95756169-95756191 CTGTTTCTGATTTTGGAGGACGG - Intergenic
1030000524 7:105054970-105054992 CTATTTGTGAGTGAGGATGATGG + Intronic
1030126039 7:106153412-106153434 CAGATGCTGAGTCAGGAGGAAGG + Intergenic
1030852485 7:114507864-114507886 ATGTTTGTTAGTAAGGAAGAAGG + Intronic
1030934498 7:115568449-115568471 CTGTCTCTGAATCAGGAGAAGGG - Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1031982444 7:128136422-128136444 CTGTGTCTGAGCAAGGAGGGTGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032344103 7:131104165-131104187 GTGTTTCGTGGTAAGGAGGATGG + Intergenic
1032878642 7:136065373-136065395 CTGTTACTGAGAAAGAAGGGTGG + Intergenic
1035046401 7:155970228-155970250 CTATTTCTAAGCAATGAGGAAGG + Intergenic
1036388619 8:8305186-8305208 CTGTTCCTTACTAAGGAGGCTGG + Intergenic
1038045410 8:23761750-23761772 CTGTTTCTGAGTCATCAGGAAGG + Intergenic
1038173906 8:25163700-25163722 CTGTTACTAAGGAAGGAGGGAGG + Intergenic
1041712475 8:60906965-60906987 CTGTGTCTGAGTCAGGAGATGGG + Intergenic
1044077813 8:87845330-87845352 CTGTCTATAAGTCAGGAGGATGG - Intergenic
1046541643 8:115591323-115591345 CTGATTCTGAATAAAGATGAAGG + Intronic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1047024529 8:120811686-120811708 CTGGTTCTGAGCAGCGAGGAGGG - Exonic
1048460107 8:134614473-134614495 CTGTGTGTGTGTAAGGAGAATGG - Intronic
1048934515 8:139343921-139343943 CAGTTTCTGAATTAGGAGGTGGG - Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1056053613 9:82797203-82797225 CTGGCTTTGAGAAAGGAGGAAGG + Intergenic
1056791748 9:89630240-89630262 CTGCTTCTGGAAAAGGAGGAGGG - Intergenic
1059431703 9:114254429-114254451 CTGTTTCTGCCAATGGAGGATGG + Intronic
1060894117 9:127206725-127206747 CTGTTTCTGGGCTAGGAGGTTGG - Intronic
1061748377 9:132756646-132756668 CTGATTCTGAGCAAGCAAGAGGG + Intronic
1185927582 X:4164386-4164408 CTGATTCTGTGTAAGAAGTATGG + Intergenic
1187396500 X:18923926-18923948 CAGTTTTAGAGTAAGCAGGAAGG - Intronic
1187416000 X:19094012-19094034 CTGTTTCTGAGTTAAGATAATGG - Intronic
1189747273 X:44182098-44182120 CAGATTCTGGGTAGGGAGGAGGG - Intronic
1190369395 X:49726834-49726856 CTGTTTCTGAGTTGGCAGGGTGG + Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1192326554 X:70137246-70137268 ATGTTTCTGATTTAGGTGGATGG + Intronic
1193058749 X:77182154-77182176 CTGTTTTGGAGTCTGGAGGATGG - Intergenic
1194399458 X:93424988-93425010 CTGGTGCTGAGTATGTAGGATGG + Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1197230836 X:124002110-124002132 CAGTTACTGAGGAGGGAGGATGG + Intronic
1199126624 X:144130170-144130192 CTGTTTCTGACTGAGAAGTAGGG - Intergenic
1199428519 X:147731809-147731831 CTGTTTTTGAGTAGGCAAGAAGG + Intergenic
1200023896 X:153238691-153238713 CTGATTCTGAGCAGGCAGGAGGG - Intergenic
1200834852 Y:7723541-7723563 TGGCTTCTGAGTAAGGAGGAGGG - Intergenic