ID: 1083032753

View in Genome Browser
Species Human (GRCh38)
Location 11:59608915-59608937
Sequence ACACCCCAGGTCCTTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083032747_1083032753 24 Left 1083032747 11:59608868-59608890 CCAGATGGTTTCTCTATAGTGTG 0: 1
1: 0
2: 1
3: 9
4: 125
Right 1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1083032746_1083032753 30 Left 1083032746 11:59608862-59608884 CCATTACCAGATGGTTTCTCTAT 0: 1
1: 0
2: 2
3: 12
4: 211
Right 1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1083032749_1083032753 -1 Left 1083032749 11:59608893-59608915 CCACAGATCACCTGCACCACAAA 0: 1
1: 0
2: 0
3: 20
4: 253
Right 1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083032753 Original CRISPR ACACCCCAGGTCCTTCTCAA AGG Intronic
900150605 1:1177742-1177764 AGACCTCAGCTCCTTCTCATGGG - Intronic
902805249 1:18857294-18857316 CCTCCCCAGGTCCTTCTCCAGGG + Intronic
904535318 1:31195569-31195591 TCTCCCCAGATCCTTCTCACTGG + Intronic
904982373 1:34517478-34517500 ACACCCCAGGACCTGTTCAGGGG + Intergenic
907417055 1:54321830-54321852 AGACCCCACCTCCTTCTCATGGG - Intronic
907909994 1:58816896-58816918 TCAACCCAGGTGCTTGTCAATGG + Intergenic
908976453 1:69904833-69904855 AGACGCCAGGGCCTACTCAAGGG - Intronic
911740887 1:101385830-101385852 AGATCCCAGGTCCTTGACAATGG - Intergenic
912141858 1:106739989-106740011 TCAACCCAGGTCCCTATCAATGG + Intergenic
913480010 1:119279184-119279206 ACACCCAAGGAACTTCTAAAGGG + Intergenic
914344842 1:146790120-146790142 CCACCCCAGGTTTTTATCAAGGG + Intergenic
915304405 1:154969489-154969511 CCACCCCAGCCCCTTCACAAAGG + Intronic
920246051 1:204588593-204588615 ATAGCCTGGGTCCTTCTCAAGGG + Intergenic
922051424 1:221994150-221994172 ACTCCCTAGTTCCTTCCCAAAGG - Intergenic
1063124119 10:3124872-3124894 ACAGCCCAGGTCCTCATGAAAGG - Intronic
1063243231 10:4192538-4192560 CCACCCCATGGCCCTCTCAAGGG - Intergenic
1063325196 10:5093114-5093136 ACACCCCAGCTTCCCCTCAATGG + Intronic
1067194233 10:44101542-44101564 AGACCCCAGGTGCCTGTCAAGGG + Intergenic
1068088684 10:52406399-52406421 AAACCCCAGTTACTCCTCAAAGG - Intergenic
1068555118 10:58449962-58449984 ACCTCTCAGGTCCTTCTAAATGG + Intergenic
1069600009 10:69698171-69698193 CCACACCAGGTCCTACTGAAGGG - Intergenic
1070330319 10:75411761-75411783 ATACCCCAGGTCCTTAACAATGG - Intergenic
1072918931 10:99559099-99559121 ACACCCTCGGTCCTTCCTAAGGG - Intergenic
1074206615 10:111288308-111288330 ACACCCCAGGGCCTAGTCCAGGG - Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1076907151 10:133368486-133368508 AGAGCCCAGGCCCTTCTCACGGG + Intronic
1077606678 11:3617070-3617092 AGACACCAGGTCTTTCTCACTGG + Intergenic
1080830621 11:35890373-35890395 CCACCCCAGGTTCTCCTCTAAGG - Intergenic
1080955065 11:37083780-37083802 CCTCACCAGGTCCTTGTCAATGG + Intergenic
1081938500 11:46920861-46920883 GCATCCCAAGTCCTTCTCCACGG + Intergenic
1083032753 11:59608915-59608937 ACACCCCAGGTCCTTCTCAAAGG + Intronic
1083473322 11:62899008-62899030 AGACTCCAGGTCCTTCTAACTGG + Intergenic
1084372989 11:68756815-68756837 AAACACCAGTTCCTTCCCAAGGG - Exonic
1084906014 11:72348181-72348203 ACATCCCTGGTCCTCCTCAGAGG - Intronic
1089980225 11:122766094-122766116 ATACCCAGGGTCCTTCTCAGTGG + Intronic
1090081645 11:123617561-123617583 ACACCACAGGCCCTACACAAAGG - Intronic
1098370694 12:69757718-69757740 AATCCCCAGTTCCTTCCCAAAGG + Intronic
1098617325 12:72544335-72544357 ACTCCCCAGGGCCTTCTGGATGG - Intronic
1099361235 12:81704553-81704575 ACACCCAAGGCCCTTCAGAAAGG + Intronic
1101494364 12:105239510-105239532 ACACCCAAAGTCCTTCCCCATGG - Intronic
1101811648 12:108112829-108112851 ACACCCCAGGTCCTTGTCCCTGG - Intergenic
1102576380 12:113858617-113858639 ACCCCCCAGGATCTTCTCCAAGG + Intronic
1104102058 12:125622061-125622083 ACACCCCAAGCCCTGCTGAAAGG - Intronic
1111278172 13:85980364-85980386 ATACACCAGGTACTTCTTAAGGG + Intergenic
1113650231 13:112029253-112029275 CCAGCCCAGGTCCTGCTCACTGG - Intergenic
1114044562 14:18712446-18712468 ACCCACCAGGTCCTTATCATTGG + Intergenic
1114048895 14:18903172-18903194 ACCCACCAGGTCCTTATCATTGG + Intergenic
1114113667 14:19498761-19498783 ACCCACCAGGTCCTTATCATTGG - Intergenic
1114115368 14:19616510-19616532 ACCCACCAGGTCCTTATCATTGG - Intergenic
1118068622 14:62220369-62220391 ACACCCAACATCATTCTCAATGG - Intergenic
1118914770 14:70093665-70093687 TCACCCCAGCTCCTTGACAAAGG - Intronic
1122235657 14:100329526-100329548 GGACCCCGGGTCCTTTTCAAGGG + Exonic
1123058433 14:105583443-105583465 ACAGCCCTGGTCCTCCTCACTGG - Intergenic
1123082766 14:105703676-105703698 ACAGCCCTGGTCCTCCTCACTGG - Intergenic
1125852435 15:42917089-42917111 ACATCCCAGATTCTTTTCAAAGG + Intronic
1126731892 15:51691911-51691933 AGACCCCAGCTCCTGCTCAGGGG - Intronic
1129787985 15:78321985-78322007 AGACCCCAGGTCCTGCTCCCTGG + Intergenic
1132566834 16:627436-627458 CCACCTCAAGTCCTTCTCGATGG + Exonic
1133823645 16:9258674-9258696 GCACCCCAGGACCTTGACAAAGG + Intergenic
1134366975 16:13588443-13588465 ACATCCCAGGTCTTTCTCATGGG - Intergenic
1139989149 16:70925186-70925208 CCACCCCAGGTTTTTATCAAGGG - Intronic
1140519539 16:75569326-75569348 ACACCCCAGGGCCTGCCCACTGG + Intronic
1142104124 16:88292951-88292973 AGACCCCAGGGCCTCCCCAAGGG - Intergenic
1142931609 17:3289785-3289807 ACATCCCAGGTCTTCCCCAACGG + Intergenic
1143105120 17:4525807-4525829 ACAGCTCAGCTACTTCTCAAGGG - Intronic
1143514036 17:7410565-7410587 ACACCCCAGGGCCCCCTCATGGG + Intronic
1143859278 17:9876200-9876222 AAACCCCAGTTCTTTCTGAAAGG + Intronic
1145405833 17:22591423-22591445 ACACACTAGGTCCTACTAAATGG + Intergenic
1146942754 17:36855207-36855229 ACCCCCCAGGGCCTTCCCAAGGG - Intergenic
1148440092 17:47707586-47707608 TCACACCAGGCACTTCTCAAAGG - Intronic
1149629908 17:58114154-58114176 CCACCCGAGGTCCTTCTGAAAGG - Intergenic
1152722341 17:81929119-81929141 ACACCCCAACTCCTCCTCACAGG + Intergenic
1152797907 17:82316979-82317001 ACAGCCCAGGTCCTCCCCAGAGG - Exonic
1152854670 17:82658018-82658040 CCACCTCAAGTCCTTCTCGATGG - Exonic
1153493225 18:5671288-5671310 AGAGCCCAGGTCCTTTTCCACGG + Intergenic
1157537694 18:48472088-48472110 CCACCCCAGGGCTTGCTCAATGG - Intergenic
1160591539 18:79947602-79947624 CCACCCCAGCCCCTTCTCACCGG + Intronic
1161231381 19:3176689-3176711 ACACCCCAAGGCCTTCTGGATGG + Intronic
1161585571 19:5103682-5103704 CCACCCCAGGTTTTTCTTAAGGG + Intronic
1164575260 19:29402038-29402060 CTACACCAGGTCCTCCTCAACGG - Intergenic
1165327182 19:35121002-35121024 ACTCCCCAGGCCCTGCCCAAAGG + Intronic
1165737334 19:38185028-38185050 ACACCCCAGGGCCTTTGCACTGG + Intronic
926418480 2:12674303-12674325 AGACCCAATGCCCTTCTCAACGG - Intergenic
927319834 2:21730199-21730221 ACACCTCATGTCCTTCTTTAGGG - Intergenic
927885717 2:26717365-26717387 ACACCCCTGTTTCTCCTCAATGG + Intronic
928359468 2:30651433-30651455 ACACCCCAAGACCTTTTCAGGGG - Intergenic
929634301 2:43501561-43501583 ATACCCAAGGTCATTCTGAAGGG + Intronic
932231745 2:70088786-70088808 GCACCCCATGCCCTTCTCAGAGG - Exonic
932975444 2:76594727-76594749 TCACCCCAGGTATTTCTCAAAGG - Intergenic
936094819 2:109523592-109523614 ACCTCTCAGGTCCTTCTAAAGGG - Intergenic
937474302 2:122201401-122201423 ACTCCCCAGTGCCTGCTCAATGG - Intergenic
938426210 2:131191428-131191450 ACCCACCAGGTCCTTATCATTGG + Intronic
938790393 2:134671017-134671039 GCACCCCAGGTTGCTCTCAAAGG + Intronic
943177237 2:184492368-184492390 AGACACCAGGTCCTACTTAAGGG + Intergenic
944176183 2:196831288-196831310 ACACCCCAGAACCTTCGAAAAGG + Intergenic
944912327 2:204322801-204322823 ATACCCCAAGTGCTTGTCAATGG - Intergenic
947181031 2:227411601-227411623 AATCCCCAGGTCTCTCTCAATGG - Intergenic
947819949 2:233062589-233062611 GCACCACAGGTCCCTCTCTAAGG - Intronic
948709604 2:239817647-239817669 CCAGCCCAGGTCCCTCTTAAGGG + Intergenic
1171849729 20:30299806-30299828 CTAGCCCAGGTCCTTCTCCAGGG - Intergenic
1174969477 20:55257767-55257789 ACACTCAAGGCCCTCCTCAAAGG - Intergenic
1175342703 20:58244481-58244503 ACACACCAGGCCCTTCCCAATGG + Intergenic
1175979749 20:62732288-62732310 ACAGCCCATGTCATACTCAATGG - Intronic
1178182261 21:30175146-30175168 ACACTCTAGGTTCTTCTCAAGGG - Intergenic
1178934849 21:36852492-36852514 ACACCCCAGGTCCTGCTGCTTGG + Intronic
1180561652 22:16620108-16620130 ACACCCCAGGCTCTTCTGACTGG + Intergenic
1183287559 22:36977076-36977098 TCACCCCAGCTCCTTCTTCACGG - Intergenic
1183742432 22:39676226-39676248 CCACGCCAGATCCTTCTCAGCGG + Intronic
1184088432 22:42279894-42279916 CCACCCCAGGTGCTCCTCACAGG + Intronic
1184910600 22:47531517-47531539 CCTCCCCAGGGGCTTCTCAAGGG - Intergenic
1185221825 22:49632928-49632950 AGACCCCAGGCCGTGCTCAATGG - Intronic
949123570 3:418049-418071 TAACCCCAGGTTCTTATCAATGG + Intergenic
950765997 3:15273440-15273462 ACAGCACATGTTCTTCTCAAAGG - Intronic
951671561 3:25189410-25189432 GCTCCTCAGGTCCTTGTCAAGGG - Intronic
953239517 3:41136297-41136319 ACTCCCCAGTTCCTTCTGCAGGG + Intergenic
953563232 3:44011227-44011249 ACCCCCCAGGTACTTCTGAGGGG + Intergenic
956018876 3:64912699-64912721 GCTCCCCAGGTGATTCTCAAGGG - Intergenic
957767615 3:84646669-84646691 TCAACCCAGGTGCTCCTCAATGG - Intergenic
961749565 3:129087315-129087337 ACACCCCAGGTTCCTCCCATTGG - Intergenic
964281422 3:155070887-155070909 ACACCCCAGATTTTTCTCAGGGG - Intronic
964566133 3:158055285-158055307 ACAGCTCAGGGCCTTCTCACTGG + Intergenic
965042273 3:163524616-163524638 ACTCCCCACTTCCTACTCAATGG - Intergenic
965797730 3:172458659-172458681 TCATTCCAGCTCCTTCTCAAGGG + Intergenic
967158442 3:186714355-186714377 GCACCCCAGCTTCTTCTCAGAGG - Intergenic
967877613 3:194277626-194277648 ACCTCCCAGGTCCTCCCCAAAGG + Intergenic
968053274 3:195671231-195671253 AGACGCCAGGTCCTTCGCGATGG - Intergenic
968102537 3:195977130-195977152 AGACGCCAGGTCCTTCGCGATGG + Intergenic
973740734 4:53917025-53917047 ACAGCCCAAGTCCTTCTCTCCGG + Intronic
973893873 4:55393681-55393703 ACACTCCAGGGCTTTCTCACAGG - Intergenic
979932084 4:126643377-126643399 ACTCCCCCAGTCCTTCCCAAGGG + Intergenic
980156871 4:129117994-129118016 ACACCCCTGGGCCTTCCCACTGG + Intergenic
980555648 4:134400348-134400370 TCACCCCAGGTCCCCATCAATGG - Intergenic
981088875 4:140712189-140712211 AAACGCCAGGTCCCTCTCCAAGG - Intronic
986113011 5:4739011-4739033 CCACCCCAGGCCTTTCTAAAAGG + Intergenic
986779930 5:11055821-11055843 ACACCCTAGGTCCTTGTGGATGG + Intronic
990361219 5:55022035-55022057 AACCCCCAGGGACTTCTCAAAGG + Intronic
998236384 5:140401999-140402021 AGAGTCCAGGTCCTCCTCAAAGG - Exonic
999272894 5:150307893-150307915 CCACCCCAAGGCCTGCTCAAAGG + Intronic
1005842943 6:29756130-29756152 ATCCCTCAGGTCCTTCTCAGTGG - Intergenic
1008665972 6:53716883-53716905 ATCCCCCAAGTCCTTCTCATAGG - Intergenic
1010360071 6:74982954-74982976 TCACCCCAGGTGCCTATCAATGG - Intergenic
1011412001 6:87075532-87075554 ACACCTCAGGGCTTTCTCATGGG + Intergenic
1017067561 6:150543375-150543397 CCACCCCAGGTCCTTTGCACTGG + Intergenic
1017801322 6:157898863-157898885 ACACCCCTGGTCCTGCTGACAGG - Intronic
1023536859 7:41222487-41222509 AGACCACAGGTCCCTGTCAATGG + Intergenic
1024221216 7:47288696-47288718 CCAGCCCAGGTCCCTCACAAGGG + Intronic
1030940996 7:115649997-115650019 ATTCACCAGGTCCTTCTCTATGG - Intergenic
1033241192 7:139681351-139681373 ACTTCTCAGGTCCTTCTAAATGG + Intronic
1036737995 8:11336308-11336330 CCACCCCAGGTCCTGGTAAATGG - Intergenic
1038436769 8:27541755-27541777 ACACCCCAGCTCCATCCCCAAGG - Intronic
1039879423 8:41615230-41615252 ACTCCCCAGGCCCTTCTAAGGGG - Intronic
1039917545 8:41871116-41871138 ACACCCCAGGAGCTTCTGGAGGG + Intronic
1041313297 8:56537956-56537978 ACACCCAGGGGCCTTGTCAAAGG + Intergenic
1048184779 8:132229728-132229750 ACACCCCAGGGCCTTCCAAGAGG + Intronic
1048225850 8:132584663-132584685 CCTCACCAGGTCCTTCTCTATGG + Intronic
1048793240 8:138123693-138123715 ATACCCCAGGTCCTTTCTAAAGG + Intergenic
1050143783 9:2544080-2544102 AGCCTCCAAGTCCTTCTCAAAGG + Intergenic
1054157622 9:61651669-61651691 CTAGCCCAGGTCCTTCTCCAGGG + Intergenic
1054477396 9:65582674-65582696 CTAGCCCAGGTCCTTCTCCAGGG + Intergenic
1056569479 9:87803043-87803065 ACTCCCTAGGTCCTTCCCACTGG + Intergenic
1060859542 9:126943463-126943485 ACTCTCCAGGTCCTGCTGAAAGG - Intronic
1061910433 9:133719517-133719539 CCACCCCAGGTCCCTCTTCAGGG + Intronic
1185520930 X:739271-739293 AGACCCCTCGTCCCTCTCAAAGG + Intergenic
1186750491 X:12616674-12616696 ACACTGCAGCTCCTTCCCAAGGG - Intronic
1187092920 X:16116428-16116450 ACACACCATGTTCTTCTCTAAGG - Intergenic
1188760294 X:34019576-34019598 TCAACCCAGGTGCTTATCAATGG + Intergenic
1194931962 X:99900002-99900024 ACCCTCCAGGTCCTGCTTAAAGG + Intergenic
1195239631 X:102937978-102938000 CCACCTCAAGTCCTTCTCCATGG + Exonic
1195298077 X:103500075-103500097 CCACCTCAAGTCCTTCTCCATGG - Exonic
1196010559 X:110882992-110883014 AGACCCCAGGACCTTCTTGAAGG - Intergenic
1197408236 X:126082235-126082257 ACACCCCAGGGCCTACTTAAGGG - Intergenic
1197726683 X:129781341-129781363 CCACCCCAGCTGCTTCTCTAAGG + Intronic
1197810488 X:130437537-130437559 AGACACCAGGGCCTACTCAAGGG - Intergenic