ID: 1083033492

View in Genome Browser
Species Human (GRCh38)
Location 11:59615499-59615521
Sequence GACGGTGGTCGCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2416
Summary {0: 1, 1: 1, 2: 16, 3: 270, 4: 2128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083033492_1083033502 0 Left 1083033492 11:59615499-59615521 CCGCCGCCGCCGCGACCACCGTC 0: 1
1: 1
2: 16
3: 270
4: 2128
Right 1083033502 11:59615522-59615544 CCTGACGCGGCCCCGGAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 193
1083033492_1083033498 -7 Left 1083033492 11:59615499-59615521 CCGCCGCCGCCGCGACCACCGTC 0: 1
1: 1
2: 16
3: 270
4: 2128
Right 1083033498 11:59615515-59615537 CACCGTCCCTGACGCGGCCCCGG 0: 1
1: 0
2: 0
3: 9
4: 98
1083033492_1083033506 16 Left 1083033492 11:59615499-59615521 CCGCCGCCGCCGCGACCACCGTC 0: 1
1: 1
2: 16
3: 270
4: 2128
Right 1083033506 11:59615538-59615560 AGCCTGGCCCCGCATCTCCGCGG 0: 1
1: 0
2: 0
3: 32
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083033492 Original CRISPR GACGGTGGTCGCGGCGGCGG CGG (reversed) Exonic
Too many off-targets to display for this crispr