ID: 1083036043

View in Genome Browser
Species Human (GRCh38)
Location 11:59638566-59638588
Sequence AACACTGAACTGGGTACAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083036043 Original CRISPR AACACTGAACTGGGTACAAC AGG (reversed) Intronic
902270762 1:15302876-15302898 CACCCTGAACTGGGTACAGAAGG - Intronic
903630164 1:24762646-24762668 AACACTCAGCTTGATACAACTGG - Intronic
904310326 1:29625181-29625203 AACATTAAAATGGATACAACTGG + Intergenic
906267252 1:44442095-44442117 AACATTCAACTGGGGACATCAGG - Intronic
906647992 1:47490013-47490035 ATCACTGAACAGGGCACAAGGGG + Intergenic
907317960 1:53584568-53584590 AGCACTGAACTTGGCACAAGGGG + Intronic
907676244 1:56520399-56520421 AAAACAGCACTGGGTACACCGGG + Intronic
912268844 1:108188970-108188992 AACACAAAACTGGCTAAAACTGG - Intronic
913256052 1:116954572-116954594 AATCCTGAACTGTGTACAATAGG - Intronic
915588250 1:156856717-156856739 AGCCCTGGACTGGGCACAACTGG - Intronic
917107020 1:171502505-171502527 AAAACTCAACTGGGTAAAAAGGG - Intronic
919284512 1:195538405-195538427 AACTCTGAACTGGGTCTATCTGG - Intergenic
920263637 1:204706461-204706483 AATACTGCACTGGGGACAGCAGG - Intergenic
1064242586 10:13644704-13644726 CAGACTGAACTGTGTGCAACAGG - Exonic
1068583873 10:58774373-58774395 AACATTGTACTGGGGAAAACAGG + Intronic
1074088814 10:110227613-110227635 AACACTGAGCGGGGGAAAACCGG + Intronic
1075921012 10:126213083-126213105 AACACTGTGCTGGATACGACAGG - Intronic
1083036043 11:59638566-59638588 AACACTGAACTGGGTACAACAGG - Intronic
1083202967 11:61131463-61131485 AACTCTGCACTGGGTTCAAATGG + Exonic
1086891328 11:92261618-92261640 TGTACTGAACTGGGTCCAACCGG - Intergenic
1088753961 11:112869933-112869955 AAGAATGAAGTGGGAACAACTGG + Intergenic
1089713033 11:120330750-120330772 AACTGTGAAGTGAGTACAACTGG + Exonic
1091233713 11:134005091-134005113 AACACTGCACTGTGGAAAACGGG - Intergenic
1091844902 12:3648392-3648414 AACACTGCACTGGGGACCAAGGG + Intronic
1098079296 12:66766807-66766829 AACACTGAACTAGGAAGAGCAGG - Intronic
1098685949 12:73421442-73421464 AACAATGAACTGCGCAAAACAGG - Intergenic
1099276597 12:80584163-80584185 AACACTGATCTAGGTACAGATGG - Intronic
1103741091 12:123092109-123092131 CACACTGGAGTGGGTACGACAGG + Intronic
1104393575 12:128412178-128412200 AACCCTGAATTGGTTACAAATGG - Intronic
1109382396 13:61580933-61580955 AACACTGATTTGAGGACAACTGG + Intergenic
1110807614 13:79775126-79775148 AATACAGAAATGGGTCCAACTGG + Intergenic
1112644901 13:101319026-101319048 AATAATAAACTGGGTACCACTGG + Intronic
1117414184 14:55478673-55478695 AAGACTGAAATGTGTACAATTGG - Intergenic
1117580327 14:57145058-57145080 AACTCTGAACTGGGTATAATGGG - Intergenic
1119780504 14:77273934-77273956 CACACTGATCTGGGTGCACCTGG + Intergenic
1122282330 14:100630588-100630610 AACACTGAACTGGGGCAAAATGG + Intergenic
1122783642 14:104154225-104154247 AACACTGATCTGGGGCCAGCGGG + Intronic
1123431490 15:20220861-20220883 AACAATGAATGAGGTACAACTGG + Intergenic
1126008804 15:44283389-44283411 AACACAGTAATGGGTACAAGGGG + Intergenic
1130467273 15:84198784-84198806 AACACTGAACTGGGTAGGGAAGG + Intergenic
1130496989 15:84474752-84474774 AACACTGAACTGGGTAGGGAAGG - Intergenic
1133052575 16:3125573-3125595 AGAAATGAACTGGGTAAAACAGG + Intergenic
1135904661 16:26500182-26500204 AGAACTGAACTGGGTACATGGGG + Intergenic
1138117103 16:54369568-54369590 AACACTGAATTGGGGACTGCTGG - Intergenic
1141323076 16:83030245-83030267 AACACTGAACTCGTTGGAACTGG + Intronic
1141683912 16:85559350-85559372 CACACTGAACTGGGAATAAGGGG + Intergenic
1146118058 17:30160759-30160781 GACACTGTACTGGATACTACTGG + Intronic
1149289940 17:55208324-55208346 CACACCGTACTGGGTGCAACAGG - Intergenic
1151145737 17:72039216-72039238 AAACCTAAGCTGGGTACAACAGG - Intergenic
1156288640 18:35724169-35724191 AACACTGCACTGGGTTTCACAGG - Intergenic
1157188167 18:45558267-45558289 AAGACTGAACTGGCTTCAAGTGG - Intronic
1157904658 18:51558841-51558863 AACACTAAACGGAGTAAAACAGG - Intergenic
925570364 2:5304085-5304107 AACACAAAAATGGGTACAAGTGG + Intergenic
925995051 2:9285365-9285387 AACACTGAACTGGGACAAAAGGG + Intronic
926181288 2:10645882-10645904 AGCCCTGAACTGGGACCAACAGG + Intronic
928527751 2:32159671-32159693 AACAGTAAACTAGGCACAACAGG + Intergenic
928842238 2:35623930-35623952 AGCACTGATCAGAGTACAACTGG + Intergenic
929790118 2:45016123-45016145 AAGACAGGAATGGGTACAACAGG + Intergenic
929801553 2:45108811-45108833 AACAGTCAGCTGAGTACAACAGG - Intergenic
930471978 2:51828197-51828219 GACTCTGAAATGGGTACAACAGG - Intergenic
930472130 2:51830201-51830223 GACCCTGAAATGGATACAACAGG + Intergenic
931420447 2:62122286-62122308 AACATTGAACAGGGTAGAATGGG - Intronic
931437278 2:62259204-62259226 AACAATTAACTGTGGACAACAGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932800625 2:74739507-74739529 AGCACTGGACTGGGGACAGCAGG - Intergenic
933751705 2:85606725-85606747 AACACTTAAAAGGATACAACAGG + Exonic
935317989 2:101856367-101856389 ACCACTTAACTGGTTTCAACAGG - Intronic
937144840 2:119635742-119635764 AATACTGTAGTGGTTACAACCGG + Intronic
938822800 2:134976069-134976091 GCCACTCCACTGGGTACAACTGG + Intronic
942421380 2:175811635-175811657 AACAGTGAAAGGGGTATAACAGG + Intergenic
942551952 2:177129030-177129052 AACACTGGACTGGGAATAAAAGG + Intergenic
947405931 2:229777370-229777392 TAAACTGATCTGGCTACAACTGG + Exonic
1168964932 20:1893713-1893735 ATCACTGACCTGGCTACTACAGG + Intergenic
1179029179 21:37704977-37704999 AACACTGAATTGGGTAGAACTGG + Intronic
1179943150 21:44652690-44652712 AACACTGAAATGGCCAAAACTGG + Intronic
1181758595 22:25042307-25042329 AATAATGAACAGGATACAACAGG - Intronic
952583122 3:34858303-34858325 AACACAGAACTGTGTAGAAGAGG - Intergenic
957434811 3:80161179-80161201 AAATTTGGACTGGGTACAACAGG + Intergenic
962711054 3:138086496-138086518 AACAGTGAACAGGGAGCAACAGG - Intronic
963383041 3:144556112-144556134 AACACTGTTATGGGTACAATGGG + Intergenic
963500261 3:146116685-146116707 AACAATAAAATGGTTACAACTGG + Intronic
969302080 4:6303031-6303053 CACACTGAGCTGGGCACCACAGG + Exonic
972401827 4:38711898-38711920 AACATTTACCTGGGTAAAACTGG + Intergenic
975052864 4:69887780-69887802 AACACACAACTGGTTATAACAGG - Intergenic
976019562 4:80604693-80604715 CACAATGAACTGGATAGAACTGG + Intronic
977222172 4:94350821-94350843 AAAAATGAACTGGGAACAGCAGG - Intergenic
981049014 4:140292805-140292827 AAAACTGAGATGGGTACATCTGG - Intronic
990443359 5:55868875-55868897 AACTGTGTACTGGGTATAACTGG - Exonic
991048740 5:62249868-62249890 AACAATGAATGGGGTACAACTGG + Intergenic
992661083 5:78961534-78961556 AACACGGAACTGAGGACAATAGG - Intronic
995055839 5:107757899-107757921 GAGACTGAACTGGGTAAATCTGG + Intergenic
996670374 5:126111119-126111141 AACACAGTAATAGGTACAACTGG - Intergenic
999545782 5:152626812-152626834 AACACTGATCTGGGTTCCAGAGG - Intergenic
1003386799 6:5675520-5675542 AACACTGTATTGGGTACATGTGG - Intronic
1003567975 6:7236506-7236528 TACACAGGACTGGGTACAAACGG - Intronic
1004608668 6:17218052-17218074 GACACTGAACTGGGTATTAAGGG + Intergenic
1006610850 6:35293500-35293522 GACCCTGAGCTGGATACAACAGG + Intronic
1010456312 6:76059854-76059876 TAAACTGATCTGGGTACAATGGG + Intronic
1016694322 6:146974991-146975013 GACCCTGAACTGGGTTCAAGAGG + Intergenic
1019819157 7:3227886-3227908 CACACTGAACATGGTATAACTGG - Intergenic
1021106165 7:16642326-16642348 ATCACTGAACTGTGTTTAACTGG - Intronic
1021182051 7:17518362-17518384 AGCACTGACCTTGGTACTACCGG + Intergenic
1023887776 7:44373526-44373548 AACACTGCACTGGGAGGAACTGG - Intergenic
1028221799 7:88205596-88205618 AACATTGATCTGGCTACCACTGG - Exonic
1033954614 7:146831213-146831235 AACAGTGAAGTTGGTACATCTGG - Intronic
1033979516 7:147146716-147146738 AACACTGAAGTGGGTTCAGGAGG + Intronic
1035421298 7:158730831-158730853 CAAACTGAGCTGGGAACAACAGG + Intergenic
1035644733 8:1210337-1210359 AACACTGCACTGGTTTCATCTGG - Intergenic
1035816698 8:2548902-2548924 AAGACTGAACTTGGGACATCTGG + Intergenic
1038285516 8:26203292-26203314 AAGACTGTACAGGGCACAACTGG - Intergenic
1038424504 8:27455729-27455751 AAGTCTGAAGTGGGTCCAACTGG - Intronic
1039253643 8:35694208-35694230 AACACTGAACTGGGGACTGTTGG + Intronic
1041465692 8:58155656-58155678 GACACTGAACTGGGTAAAGGAGG - Intronic
1043774448 8:84247168-84247190 AGAACTGAACTGGGTAGAAATGG + Intronic
1045602042 8:103728527-103728549 CATACTGAACAGGGAACAACTGG - Intronic
1049271577 8:141698921-141698943 CACACTGACCTGGGAACAAATGG - Intergenic
1049718998 8:144106996-144107018 AAGCCTGGAGTGGGTACAACAGG + Intronic
1051024331 9:12588804-12588826 AATAATTAACTGGGTACTACTGG + Intergenic
1056008424 9:82299660-82299682 AACACTGAAGGAGGTACAAAAGG + Intergenic
1195506024 X:105658193-105658215 CACACTGAACTGTGTGTAACTGG - Intronic