ID: 1083039302

View in Genome Browser
Species Human (GRCh38)
Location 11:59670173-59670195
Sequence TAGTGTTACCATCATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083039302_1083039306 0 Left 1083039302 11:59670173-59670195 CCTGCCTCATGATGGTAACACTA No data
Right 1083039306 11:59670196-59670218 CTAACGATTGAAGGCTGCCTGGG No data
1083039302_1083039309 26 Left 1083039302 11:59670173-59670195 CCTGCCTCATGATGGTAACACTA No data
Right 1083039309 11:59670222-59670244 CTGCTAGGCGCTTTATAAAATGG No data
1083039302_1083039307 11 Left 1083039302 11:59670173-59670195 CCTGCCTCATGATGGTAACACTA No data
Right 1083039307 11:59670207-59670229 AGGCTGCCTGGGACTCTGCTAGG No data
1083039302_1083039305 -1 Left 1083039302 11:59670173-59670195 CCTGCCTCATGATGGTAACACTA No data
Right 1083039305 11:59670195-59670217 ACTAACGATTGAAGGCTGCCTGG No data
1083039302_1083039304 -9 Left 1083039302 11:59670173-59670195 CCTGCCTCATGATGGTAACACTA No data
Right 1083039304 11:59670187-59670209 GTAACACTACTAACGATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083039302 Original CRISPR TAGTGTTACCATCATGAGGC AGG (reversed) Intergenic
No off target data available for this crispr