ID: 1083045318

View in Genome Browser
Species Human (GRCh38)
Location 11:59729249-59729271
Sequence CAGGAGAACCACAATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083045318 Original CRISPR CAGGAGAACCACAATGAGGT GGG (reversed) Intronic
900361551 1:2291523-2291545 CAGGAGAACCCCAGCAAGGTTGG + Intronic
902680284 1:18038931-18038953 CAGCAGAAACACAATGACCTTGG + Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
907561258 1:55390611-55390633 AATTAAAACCACAATGAGGTAGG - Intergenic
909000668 1:70213733-70213755 CATAACAACCCCAATGAGGTGGG + Intronic
909372308 1:74898084-74898106 CAGGTGAGACACAATGAGGAAGG - Intergenic
910813834 1:91266832-91266854 CAGGAGAATCTCCATGATGTGGG - Intronic
911455661 1:98119937-98119959 CAGGAGAACCATATTTTGGTGGG + Intergenic
911736465 1:101342273-101342295 CACGAGACCCACAGTCAGGTAGG + Intergenic
913701686 1:121380593-121380615 CATAATAACCCCAATGAGGTTGG - Intronic
914042247 1:144061062-144061084 CATAATAACCCCAATGAGGTTGG - Intergenic
914135843 1:144899426-144899448 CATAATAACCCCAATGAGGTTGG + Intronic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915798736 1:158765933-158765955 GATGAGAACCACAGTGAAGTGGG + Exonic
915847229 1:159279227-159279249 GATGATAACCACAGTGAGGTGGG + Intergenic
916486034 1:165259479-165259501 TATGAGAACCAAAATGATGTGGG - Intronic
917097961 1:171418391-171418413 CAGGACAACTAGAAGGAGGTGGG + Intergenic
919644218 1:200077415-200077437 CATTAAAACCACAATTAGGTTGG + Intronic
920489110 1:206399313-206399335 CATAATAACCCCAATGAGGTTGG - Intronic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923841441 1:237676046-237676068 CCGAAGAACAAAAATGAGGTAGG + Intronic
924108387 1:240672447-240672469 CAGGACAATCAAAATGTGGTTGG - Intergenic
1064366790 10:14715789-14715811 CTTGAGAACCACCAGGAGGTTGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065947923 10:30624287-30624309 CAGAAGAAGGACACTGAGGTTGG + Intronic
1066205299 10:33183101-33183123 CAGGAGAACCACATTAGGCTAGG + Intronic
1066228871 10:33412387-33412409 CAGGAGAGTCACAGAGAGGTTGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1070722976 10:78769486-78769508 CAGGAGAACCCCCATGACGCTGG - Intergenic
1075111170 10:119585908-119585930 CAGGAAAACCAGAGTGTGGTAGG - Intronic
1076258327 10:129045964-129045986 CAGGGGCACCACAATTAGATCGG + Intergenic
1077670057 11:4149113-4149135 AATCAAAACCACAATGAGGTAGG + Intergenic
1077917342 11:6619925-6619947 CAGGAGATCTACAATCAGCTGGG + Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079772605 11:24481494-24481516 GAGGGGAACCACAATGAAATTGG + Intergenic
1082139408 11:48590475-48590497 CAGGACAACCACAGTGATGCAGG - Intergenic
1082614659 11:55343919-55343941 GAGGGCAACCACAATGATGTGGG - Exonic
1082633869 11:55572846-55572868 CAAGATGACCACAATGATGTGGG - Exonic
1082902190 11:58267136-58267158 CAGCAGCACCACAGTGAGGTGGG + Exonic
1082904542 11:58292012-58292034 CAGCAGGACCACGGTGAGGTGGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083047427 11:59749369-59749391 GAGGAGAACCACAGTCAGGTGGG - Intronic
1086671263 11:89550504-89550526 CATCAAAACCACAATGAGATAGG - Intergenic
1088925887 11:114302212-114302234 CAGGTGAACAACAATCAGATGGG - Intronic
1088947323 11:114527759-114527781 CAGGAGAACTACAATTATTTAGG + Intronic
1089086905 11:115827371-115827393 CAGGAGAACCACAATTTGAAAGG + Intergenic
1090116172 11:123976900-123976922 CAGGAGCACCCCAGTGAGCTGGG + Exonic
1093611469 12:21164401-21164423 GAGGAGAACCAACAGGAGGTGGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095395579 12:41758604-41758626 CAACATAACCACAATGAGGTGGG - Intergenic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097133015 12:56827499-56827521 CAGGAGAACCACATGGTGCTGGG + Intergenic
1098177853 12:67811702-67811724 CAGGAGAAAGACAATGAGAATGG + Intergenic
1101555718 12:105807243-105807265 CATGAGAAGGACAATGAGGGAGG - Intergenic
1104178138 12:126352164-126352186 CATCAGAACCACCATGAGGTGGG - Intergenic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1104695071 12:130857255-130857277 CAGGAGAACCACACAGCAGTAGG + Intergenic
1105416665 13:20219155-20219177 CAGGAGAACCATGGTTAGGTTGG + Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1112068210 13:95817421-95817443 CAGGAGAAACAAAATTAGCTGGG + Intronic
1113109903 13:106811974-106811996 CAGGAGACCCAAACTGAGTTTGG - Intergenic
1116623198 14:47232558-47232580 AAGGTGAACCTCATTGAGGTTGG - Intronic
1117625755 14:57636139-57636161 CAGGAGAACCAGTAGGAGTTAGG + Intronic
1119667543 14:76496154-76496176 CAACAGAAACACAATGAGCTAGG - Intronic
1122924407 14:104893016-104893038 CAGGAGATCCACGATGTGGCTGG + Exonic
1123188995 14:106549998-106550020 CAGGAGAACAGCAAAGAGGAAGG - Intergenic
1123691887 15:22845018-22845040 CAGGTGAACCACATGGAGCTTGG + Intronic
1125602267 15:40922162-40922184 CAGGAGAAACAAAGTGAGTTTGG + Intergenic
1126261528 15:46698484-46698506 CAGGCGAGCCACAAGGAGCTGGG + Intergenic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1126969249 15:54091103-54091125 CAGGGGAACCCCACTGAGGAAGG - Intronic
1127959216 15:63878632-63878654 CAAGAGAACCCCAGGGAGGTTGG + Intergenic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1132153329 15:99477562-99477584 CACTAGAACCCCTATGAGGTGGG + Intergenic
1132980182 16:2734623-2734645 CATTAGAACCACAGTGAGGCCGG + Intergenic
1133067140 16:3216335-3216357 GAGGAGAACCACAGCCAGGTGGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138514684 16:57529442-57529464 CAGGAGAGTCCCAATGAGGCAGG + Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139194650 16:64905098-64905120 CAAGAGAAACACACTGAGGGTGG + Intergenic
1142376734 16:89710585-89710607 GAGGAGATCCACAATGCCGTAGG - Exonic
1142785776 17:2221405-2221427 CAGGAGAATCACAATCATGGTGG - Intronic
1143581721 17:7831478-7831500 CAGAAGGACCACATTGAGGGGGG - Exonic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1146969070 17:37057703-37057725 CAGAAAAACCACAACGAGGCCGG - Intergenic
1147117785 17:38314955-38314977 CAGGAGAGACATAATGAAGTGGG - Intronic
1147920505 17:43913756-43913778 TAGGTGAACCCCAATGAGGAGGG - Intergenic
1149370765 17:55991701-55991723 CAGGAGAGACACAATCTGGTAGG + Intergenic
1151339677 17:73462802-73462824 CCTGAGAGCCACAGTGAGGTGGG - Intronic
1151361572 17:73592467-73592489 CAGGCCAACCACATGGAGGTGGG + Intronic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162934577 19:13975273-13975295 CAGGAGAACCACCCTGAAGGTGG + Intronic
1163198327 19:15742126-15742148 CATGACCACCACAGTGAGGTGGG - Exonic
1163708987 19:18834067-18834089 CATGAAAACTACAAGGAGGTGGG - Intronic
1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG + Intronic
1165164873 19:33845452-33845474 AAGGAGATACACAATGAAGTGGG + Intergenic
1165398934 19:35585352-35585374 CAGGAAATCCCCAATGTGGTAGG - Intergenic
1166012219 19:39950974-39950996 CAGGAGTACAACAACGAGTTAGG + Intergenic
1166239961 19:41483978-41484000 CATTAAAACCACATTGAGGTTGG + Intergenic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
926432551 2:12803131-12803153 CTGGAAGACCACAATGAGATGGG + Intergenic
927494637 2:23544197-23544219 CACGAGAACCACGGTGATGTGGG + Intronic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
930977388 2:57479902-57479924 CAGGAGGCACACAATGAGATGGG - Intergenic
931618718 2:64188545-64188567 CAGAAGGACCAAACTGAGGTGGG + Intergenic
931622903 2:64229046-64229068 CAGGAAAAAAACCATGAGGTAGG - Intergenic
932730633 2:74219554-74219576 CAGTAAAACACCAATGAGGTTGG + Intronic
934748613 2:96776907-96776929 AATTAAAACCACAATGAGGTGGG - Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
939434878 2:142162605-142162627 AATTAAAACCACAATGAGGTTGG + Intergenic
941651494 2:168097327-168097349 CTGTAGAACCTAAATGAGGTGGG - Intronic
942579136 2:177397581-177397603 AATGCAAACCACAATGAGGTTGG - Intronic
948006546 2:234613943-234613965 CAGGAGAAAAACCATCAGGTGGG + Intergenic
948171864 2:235910246-235910268 CAAGAGCACCCCAATGTGGTGGG - Intronic
948427041 2:237894909-237894931 AAGGAGAACCACAACCAGATAGG - Intronic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1171120569 20:22565348-22565370 CAGGTGAACTAAAATGAGATAGG + Intergenic
1171203494 20:23260532-23260554 GAGGAGAGCCACAGTGAGTTGGG - Intergenic
1171296597 20:24022326-24022348 GAGGAGAACAACCTTGAGGTGGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175398912 20:58688272-58688294 TAAGAGATACACAATGAGGTAGG + Intronic
1180744539 22:18078501-18078523 CAGGTGCACCACCAGGAGGTCGG - Exonic
1181372217 22:22427625-22427647 CAGAAGAGCCAGAATCAGGTTGG - Intergenic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184872928 22:47252182-47252204 CAGGAGCCCCACACTCAGGTGGG + Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
952441823 3:33338317-33338339 CAGGAGAACCACTTGAAGGTGGG + Intronic
952859915 3:37804409-37804431 CAAATGAACCACCATGAGGTTGG - Intronic
952867706 3:37865670-37865692 CAGGAGAATCACTATGATGTTGG - Intronic
952995597 3:38878813-38878835 CTGGAGAACCATAATGTTGTTGG - Intronic
953043852 3:39278263-39278285 AAGAAGAACCACACTGAAGTTGG + Intronic
953785194 3:45906159-45906181 CAGGAGATCCATAGTGTGGTTGG + Intronic
953839016 3:46373651-46373673 CAGGAGAAGGACAATGTTGTAGG - Exonic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
956927758 3:74007823-74007845 TAGGAAAACCAGAATGAAGTGGG + Intergenic
960918099 3:122717764-122717786 GAGGAGGAACACAATGAGCTGGG + Intronic
962473310 3:135732484-135732506 CAGGAGAACCTCTCTGACGTGGG - Intergenic
962784695 3:138757107-138757129 CATAAAAACCACAATGAGGCTGG + Intronic
965499439 3:169440469-169440491 CAGGAGAAACCCAATGAGCAAGG + Intronic
970274524 4:14383890-14383912 AAGGAGAACCACCATAAAGTGGG - Intergenic
971896310 4:32600831-32600853 TAGCAGAACTACAATGAGTTTGG + Intergenic
980442962 4:132871346-132871368 CAGCACAGCCACAAGGAGGTAGG + Intergenic
980822578 4:138036652-138036674 CTGGAGAAGGACAAAGAGGTTGG - Intergenic
981611699 4:146600138-146600160 CAACAGAACCACAATGATGAAGG - Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982323129 4:154101137-154101159 CTGGAGATACACAGTGAGGTGGG - Intergenic
982694910 4:158588711-158588733 CAGGAAAACACCAATGAAGTTGG + Intronic
983214632 4:164991774-164991796 CAAGGGAACCAAAAAGAGGTTGG - Intergenic
984184823 4:176531137-176531159 AAGCAGAACCCCAATGAGCTAGG - Intergenic
985042795 4:185908752-185908774 TAGGAGACCCACAATGATGGAGG + Intronic
986737086 5:10675853-10675875 CAGGAAAGTCACACTGAGGTTGG - Intergenic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
989700390 5:44257413-44257435 CATGTGAACCTCAATGAGATAGG - Intergenic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
993760831 5:91795139-91795161 CAGAAGAACTAAAATCAGGTTGG + Intergenic
996154384 5:120080002-120080024 CAGGAAAGGCACAATGAGGAGGG + Intergenic
1000991051 5:167912451-167912473 CTGGAGAACAACAATGAACTGGG - Intronic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1003024614 6:2543046-2543068 CAGCAGAACCACTCTGTGGTTGG - Intergenic
1003826443 6:9957952-9957974 CAGGAGAACCCCAGAGAGCTGGG - Intronic
1004989975 6:21125885-21125907 GGGGAGACACACAATGAGGTCGG - Intronic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1006091373 6:31631079-31631101 CAGGAAAACCAGAACTAGGTGGG - Intronic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1011330284 6:86197307-86197329 AATGAGAATCACAATGAGGGGGG + Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1014588559 6:123232264-123232286 CAGGCGACCCACAATGTGGAAGG + Intronic
1018006937 6:159631108-159631130 CAGGAAAAACACAATGGGGAAGG + Intergenic
1018430944 6:163722419-163722441 GTGGAGAACCACATTGGGGTGGG + Intergenic
1019367810 7:644338-644360 CTGGAGGTACACAATGAGGTGGG + Intronic
1019647392 7:2138402-2138424 CCTGAGAACCACGACGAGGTGGG + Intronic
1021891988 7:25195023-25195045 CAGGAAAATCCCACTGAGGTTGG + Intergenic
1023363548 7:39440299-39440321 CTGGAGTACCAGAATGAGATAGG - Intronic
1024330659 7:48151580-48151602 GAGGAGAACCACAGAGAAGTGGG - Intergenic
1024539597 7:50465462-50465484 CAGGAGAACCACATTGAACCTGG - Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1028287506 7:89021499-89021521 CAGCAGACACACAATCAGGTTGG - Intronic
1031912731 7:127534604-127534626 AAAGAGACCCTCAATGAGGTCGG + Intergenic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1035873101 8:3157048-3157070 CAGGAGAACAACAATAGGTTTGG + Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1040817792 8:51527201-51527223 TAGAAGACCCACAATGAGCTGGG + Intronic
1041505907 8:58597247-58597269 CAGGAGAACTGCAATAAGGCAGG + Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1048384763 8:133901834-133901856 CATGAGAACCACACCAAGGTTGG + Intergenic
1053559321 9:39173747-39173769 AAGGAGAACCACAATTAAGCTGG - Intronic
1054137790 9:61445199-61445221 AAGGAGAACCACAATTAAGCTGG + Intergenic
1055739051 9:79365663-79365685 CAGGACAGCCAAAATAAGGTGGG + Intergenic
1055900754 9:81233225-81233247 CAGAAGAACCAAGAAGAGGTGGG - Intergenic
1057444377 9:95103636-95103658 CAGGAGAACCGCAGGGACGTTGG + Intronic
1059380101 9:113916707-113916729 CACGAGAATCACAGTTAGGTGGG - Intronic
1060336120 9:122724720-122724742 CAGGACCACTACAGTGAGGTGGG - Exonic
1060648907 9:125307170-125307192 CAGGAGAATCACAGTGGGGGAGG + Intronic
1060900753 9:127255839-127255861 CAGCAGAATCACAATGACCTTGG + Intronic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1188411396 X:29876274-29876296 GAGGAGACCCACTCTGAGGTTGG - Intronic
1188675858 X:32938164-32938186 CAAGAGAACCAGAATGATTTTGG - Intronic
1189279181 X:39809210-39809232 AAGGCGAACCACATTGAGCTGGG + Intergenic
1191815090 X:65235403-65235425 AAGCAAAACCACAATGAGGTAGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic