ID: 1083048011

View in Genome Browser
Species Human (GRCh38)
Location 11:59754066-59754088
Sequence ATGTGTTAGGGGAAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 468}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083047999_1083048011 -6 Left 1083047999 11:59754049-59754071 CCCCAAACTCCCCAAAAATGTGT 0: 1
1: 0
2: 0
3: 24
4: 296
Right 1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG 0: 1
1: 0
2: 3
3: 43
4: 468
1083047998_1083048011 -5 Left 1083047998 11:59754048-59754070 CCCCCAAACTCCCCAAAAATGTG 0: 1
1: 0
2: 2
3: 26
4: 248
Right 1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG 0: 1
1: 0
2: 3
3: 43
4: 468
1083048001_1083048011 -8 Left 1083048001 11:59754051-59754073 CCAAACTCCCCAAAAATGTGTTA 0: 1
1: 0
2: 2
3: 18
4: 258
Right 1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG 0: 1
1: 0
2: 3
3: 43
4: 468
1083048000_1083048011 -7 Left 1083048000 11:59754050-59754072 CCCAAACTCCCCAAAAATGTGTT 0: 1
1: 0
2: 1
3: 25
4: 282
Right 1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG 0: 1
1: 0
2: 3
3: 43
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083048011 Original CRISPR ATGTGTTAGGGGAAGGAGGT GGG Intronic
900584578 1:3426310-3426332 ATGTGTTAGGGGCTGGTGCTGGG - Intronic
901834508 1:11915357-11915379 ATGTGATAGGATTAGGAGGTGGG - Intergenic
901908861 1:12438061-12438083 AAGTTTTAGGGGATGGGGGTGGG - Intronic
902117335 1:14132278-14132300 ATGTGCTAGGGTCAGGGGGTAGG + Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903107350 1:21093953-21093975 ATGGGGTGGGGGAAGGAGGGAGG + Intronic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
905574480 1:39032721-39032743 AAGTGCTAGGGGCAGGAGCTAGG + Intronic
906198252 1:43943103-43943125 ATGTGATAGGGGTAAGATGTGGG + Intergenic
906409020 1:45564307-45564329 AGATGTTAGGGGAAGTACGTCGG + Intronic
906641168 1:47441377-47441399 ATGTGTTAGGGGGTGGCGGGGGG - Intergenic
906716822 1:47976253-47976275 GTGTGTAAGGGGTAGAAGGTTGG - Intronic
907390129 1:54152797-54152819 AACTGAGAGGGGAAGGAGGTGGG - Intronic
907806483 1:57825528-57825550 AGGTGTTAAGGGCAGGAGGAAGG + Intronic
908327394 1:63036560-63036582 ATCTGCTTGGGGAAGGAGGTTGG - Intergenic
908535651 1:65074534-65074556 ACGTGTTAGGGGAAGGAAATGGG - Intergenic
909841543 1:80333714-80333736 ACTAGTTAGGGGGAGGAGGTGGG - Intergenic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
913172879 1:116248168-116248190 ATGTGTGTGGGGGATGAGGTGGG - Intergenic
913174585 1:116262346-116262368 ATCTGTAAGGTGAAGGAGGCTGG + Intergenic
913175822 1:116272317-116272339 ATATTTTAGGGGGAAGAGGTTGG + Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
914916096 1:151820132-151820154 AGGTGGCAGGGGAAGGAGGGGGG - Intronic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917403032 1:174673043-174673065 ATGTATTAGGGGTTGGAAGTAGG - Intronic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
918136137 1:181675485-181675507 ATGTGTTAAGAGAAGGGGATGGG + Intronic
918224622 1:182470368-182470390 ATGAGTGAGGGGAGGGAAGTAGG - Intronic
918817465 1:189207731-189207753 ATGACTTGGGGGATGGAGGTTGG + Intergenic
919022811 1:192129981-192130003 GTCTGTCAGGGGAATGAGGTGGG + Intergenic
920214666 1:204353642-204353664 ATGAGTTAGGTGTAGGAAGTAGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920577573 1:207072742-207072764 AAGTGTTGGGGGATGGAGGGCGG + Exonic
920853638 1:209646386-209646408 ATGTGTGAAGTGAAGGAGCTGGG - Intronic
920971310 1:210745784-210745806 AGGCCTTAGGGGAAAGAGGTGGG + Intronic
922118039 1:222633709-222633731 AAGGGCTAGGGGAAGGATGTGGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923115451 1:230932946-230932968 TTGTGTTATGAAAAGGAGGTAGG - Intronic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
924237598 1:242012209-242012231 ATGTGTTGGGTGAAGGAGTCTGG + Intergenic
924310323 1:242734675-242734697 TAGGGTTGGGGGAAGGAGGTGGG + Intergenic
924866292 1:247985244-247985266 AGGGGGTAGGGGAAGGAGGGAGG - Intronic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1064468236 10:15607383-15607405 ATGTATTTTGGGGAGGAGGTGGG + Intronic
1064524495 10:16239994-16240016 ATGTGTTAGTGGGAGGAGCCAGG + Intergenic
1064635985 10:17367423-17367445 ATGTGTTGTGGGAAGGACCTGGG - Intronic
1066542142 10:36458809-36458831 ATGTATTGGGGGAAGGACCTTGG - Intergenic
1067278994 10:44857297-44857319 ATGGGGTAGGTGAGGGAGGTGGG - Intergenic
1067302734 10:45027386-45027408 ATATGTTAGGAGAAGGATATTGG + Intergenic
1067525763 10:47037562-47037584 AGCTGTTAGGGAAGGGAGGTGGG - Intergenic
1067819016 10:49510399-49510421 ATATGTAAGGGGAAGGATTTGGG - Intronic
1068576939 10:58694710-58694732 ATGTGTTTGGGGGTGGTGGTGGG + Intronic
1069069727 10:63980896-63980918 ATGTGTTGTGGGAAGGACCTAGG + Intergenic
1069329605 10:67276697-67276719 ATATGTGAGGGGAATGAAGTGGG + Intronic
1069718451 10:70535260-70535282 ATGCCTTAGCGAAAGGAGGTGGG + Intronic
1069780781 10:70954099-70954121 ATGTGCTGAGGGAAGAAGGTGGG - Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1070654077 10:78259094-78259116 ATGTGATAGGGTTAAGAGGTGGG + Intergenic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072798151 10:98372446-98372468 GTGTGTTAGGGGGCAGAGGTAGG - Intergenic
1072920746 10:99575151-99575173 ATGGGGTAGGGGAGGGAGCTAGG - Intergenic
1073302855 10:102481456-102481478 TAGTGATAGGTGAAGGAGGTTGG - Intronic
1074111266 10:110424182-110424204 GTGGGTTAGTGGAGGGAGGTGGG + Intergenic
1074252988 10:111772180-111772202 ATTTATTATGGGAAGGGGGTAGG - Intergenic
1074328629 10:112479652-112479674 ATGAGTTACGGGAAGGTGGGGGG - Intronic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1077887022 11:6394082-6394104 GTGGGATAGGGGAAGGAGGTTGG + Intronic
1078989054 11:16626965-16626987 ATGTGAGACGGGAGGGAGGTGGG - Intronic
1079137931 11:17786840-17786862 ATGTGTTGGGGGGCGGGGGTCGG + Intergenic
1079364190 11:19794752-19794774 TTATGTGAGGGAAAGGAGGTTGG - Intronic
1079446581 11:20562245-20562267 CTGTGCTTGGGGCAGGAGGTTGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083185236 11:61013808-61013830 AAGTGTTGGGGGAATGAGGAGGG + Intronic
1084180348 11:67442906-67442928 GTGTGTCGGGGGCAGGAGGTGGG + Intronic
1084322480 11:68381358-68381380 ATGTGGTCGGGGACAGAGGTGGG + Intronic
1084951452 11:72668480-72668502 ATGTGTTGGGGGGTGCAGGTAGG - Intronic
1086669926 11:89533868-89533890 CTGTTTCAGGGGAAGGATGTGGG - Intergenic
1086778473 11:90870992-90871014 GTGTGTTAGGGGTATGAGGAGGG + Intergenic
1087284277 11:96247859-96247881 ATGTGTTGGTGGAAGGTTGTTGG - Intronic
1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG + Intergenic
1089133636 11:116232101-116232123 AAGGGCTGGGGGAAGGAGGTGGG - Intergenic
1089581875 11:119486532-119486554 GTGTGTTAGGGGAGGGGGGTAGG + Intergenic
1089787757 11:120920370-120920392 ATGTGTTTGGGGACCGAGGTGGG - Intronic
1090172621 11:124617990-124618012 ATGTGTTGGGGGATGGGGGTAGG + Intronic
1091011399 11:132004138-132004160 GTGTGTCAGGGGAATGAGGGGGG + Intronic
1091017603 11:132066874-132066896 GTGTGTTTGGTGGAGGAGGTTGG - Intronic
1092040790 12:5382443-5382465 ATGTGTAAGGGCAAGGATGGAGG + Intergenic
1092245879 12:6864007-6864029 ATGTGTTTGGGGGAGGATGGAGG - Intronic
1092534776 12:9377708-9377730 GTGGATTAGGGGAAGGAGCTTGG - Intergenic
1093319204 12:17691841-17691863 GTGTGGTAGGGGGAGGAGGGAGG + Intergenic
1093429336 12:19066306-19066328 ATTTGTTAGAGAAAGGGGGTTGG - Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094236862 12:28177903-28177925 ACGTGTTGAGGGAGGGAGGTGGG + Intronic
1095527887 12:43149920-43149942 ATATGTTTGTGGAAGGAGGTAGG + Intergenic
1096567732 12:52495357-52495379 ATGTGTGTGGGGGAGGAGGGTGG + Intergenic
1096608619 12:52786296-52786318 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
1098396945 12:70029048-70029070 ATGTGTTTGGGGATGGGGTTAGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1100518539 12:95351572-95351594 ATGTGTTTGAGGCAGGAGGTTGG - Intergenic
1101987458 12:109458729-109458751 ATCTGGAAGGGGAAGGAGCTGGG - Intronic
1102088009 12:110159823-110159845 ATGTGTTTGGGGCTGGAGGTGGG + Intronic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1103104177 12:118208372-118208394 ATGTTTTGTGGAAAGGAGGTGGG - Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1104917841 12:132275202-132275224 ATGTTTTATGGGAAGGAGGAGGG - Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106451445 13:29886330-29886352 ATGTTTTCTGGGAAAGAGGTGGG - Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106463956 13:29996280-29996302 ATATGTGAGGGGTAGGAGGTGGG - Intergenic
1106466652 13:30019847-30019869 AAGTGACAGGAGAAGGAGGTGGG + Intergenic
1107675650 13:42794022-42794044 GTGTGTTAGGGGCATGTGGTAGG - Intergenic
1108413835 13:50177485-50177507 GTGTGTTGGGGGTAGGAGGTGGG + Intronic
1109894060 13:68659042-68659064 ATTTGTTGGGGGAAGAAGGGAGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111662315 13:91226433-91226455 ATGATCTAGGGGAAGGAGGGAGG + Intergenic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1114382995 14:22228196-22228218 ATTTGTCTGGGGTAGGAGGTGGG - Intergenic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1117816704 14:59606383-59606405 ATGTGATAGTGTTAGGAGGTGGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1119085080 14:71731933-71731955 ATGTGTTTGGGGGATGAGGAAGG + Intronic
1119517160 14:75257378-75257400 AAGTGTTTAGGGAAGGATGTCGG + Intronic
1119703165 14:76768739-76768761 ACGTGTGAAGGGAAGGGGGTAGG - Intronic
1119902087 14:78269803-78269825 ATGTTCTAGGAGAAGCAGGTGGG - Intronic
1121971500 14:98361039-98361061 ATGTAATAGGGGAAGAAGGACGG + Intergenic
1122461942 14:101903320-101903342 ATGTGACAGGGCAAGGAGGAAGG + Intronic
1124789631 15:32716038-32716060 GTGTGTTGTGGGGAGGAGGTGGG + Intergenic
1125436960 15:39656452-39656474 TAGTTTTAGAGGAAGGAGGTTGG - Intronic
1125458464 15:39885415-39885437 ATGGGGTAGAGCAAGGAGGTGGG - Intronic
1126168765 15:45676444-45676466 AAGTGTTAGGGCAAGAAGGTAGG + Intronic
1126920171 15:53512542-53512564 ATGTCTTAGGGAAAGGATGAAGG + Intergenic
1127008272 15:54594782-54594804 GTGTGTTCGGGAAAGGATGTTGG + Intronic
1127576128 15:60294462-60294484 ATGTGTTGTGGGAAGGACCTAGG - Intergenic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128257211 15:66205787-66205809 CTCTGGCAGGGGAAGGAGGTGGG - Intronic
1128845826 15:70893274-70893296 ATGAGACAGGTGAAGGAGGTGGG - Intronic
1128982946 15:72199596-72199618 ATGGGCTGGGGGAAGGGGGTGGG + Exonic
1129009323 15:72400887-72400909 AAGTTTTTGGGGAAAGAGGTGGG + Intronic
1129793464 15:78358202-78358224 TTGTGGCAGGGGATGGAGGTCGG + Intergenic
1130144700 15:81265039-81265061 ATGTGGTAGGGTAGGGAGGTAGG + Intronic
1130927532 15:88396652-88396674 TTGTGTTAGGTTAAGGAGGGAGG + Intergenic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1131565053 15:93478189-93478211 ATGTATGGGGGGAAGGGGGTAGG - Intergenic
1131619409 15:94051353-94051375 ATGTATTTGGGGAAGAGGGTAGG - Intergenic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1132065291 15:98725952-98725974 ATGTGTTATGGGAAGGACCCAGG - Intronic
1132180686 15:99750620-99750642 ATGTTGGAGGGGAAGGAGGGAGG - Intergenic
1132180697 15:99750667-99750689 ATGTTGGAGGGGAAGGAGGGAGG - Intergenic
1132180708 15:99750714-99750736 ATGTTGGAGGGGAAGGAGGGAGG - Intergenic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133044083 16:3076529-3076551 AAGTTTGAGGGGAAGGAGCTGGG - Intronic
1134995106 16:18733618-18733640 ATGTCTTAGAGGTAGGAGGCAGG + Intergenic
1136619807 16:31420899-31420921 AGTTGTTAGGGGAAGGAGCGAGG + Intronic
1137401896 16:48160568-48160590 ATGTGAGGGGAGAAGGAGGTGGG + Intergenic
1137704066 16:50521740-50521762 ATGTGTCAAGTGAAGGAGGGTGG - Intergenic
1138249097 16:55488796-55488818 CTGTCTTGGGGAAAGGAGGTGGG - Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140329349 16:74038398-74038420 ATGTGTTAGGGGAAAAAAGCAGG + Intergenic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1141181200 16:81754308-81754330 AGGTGACAGGGGAAGGAGGTGGG - Intronic
1141248198 16:82330536-82330558 ATGTGATAAGGGAAAGAAGTAGG - Intergenic
1141282515 16:82641646-82641668 ATGTTTTAGGGACAGGAGATGGG + Intronic
1141349863 16:83284542-83284564 ATTTTTTAGTGGAAGGAGGGAGG + Intronic
1141670217 16:85487737-85487759 CGGTGGTGGGGGAAGGAGGTGGG + Intergenic
1142650193 17:1344713-1344735 AGGAGTGAGGGGAAGGAGGTAGG + Exonic
1143562480 17:7704188-7704210 AGGTGTTGGGGGGAGGAGGGAGG - Intergenic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1145769226 17:27480268-27480290 ATGTGTTAGGTGGGGGAGGCAGG - Intronic
1145815925 17:27794971-27794993 AGGAGTTGGGGGGAGGAGGTGGG - Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146805139 17:35858867-35858889 AGGTGTGAGGGGCAGGAGGCTGG - Exonic
1146976774 17:37120238-37120260 ATAGGTTAGGGGAAGGAGGGAGG - Intronic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148395585 17:47305385-47305407 ATATGTTTGGCGAAGAAGGTGGG + Intronic
1148480312 17:47955731-47955753 ATGGGTTTCTGGAAGGAGGTGGG + Intronic
1148755515 17:49971106-49971128 ATGTGTTTGGGGACTGGGGTGGG + Intronic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151215176 17:72572149-72572171 GTGAGTTAGTGGCAGGAGGTGGG - Intergenic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1152035823 17:77871986-77872008 ATGGGGTGGGGGAAGGAGGAAGG + Intergenic
1152407318 17:80105055-80105077 ATGTCCTTGGGGAAGAAGGTGGG - Intergenic
1153392219 18:4574884-4574906 ATGTGTCAGGGGAGGGACCTGGG + Intergenic
1154339308 18:13489862-13489884 ATGGGTTAGAAGAAGGAGGGAGG + Intronic
1155508318 18:26551286-26551308 AAAAGTCAGGGGAAGGAGGTGGG + Intronic
1157353869 18:46916228-46916250 ATGGGATGGGGGAAGGATGTTGG - Intronic
1158353411 18:56589135-56589157 TTGGGTTAGGGGCAGGAGATGGG + Intergenic
1158520124 18:58165005-58165027 ATGGCTTAGGAGAAGGTGGTAGG - Intronic
1160061419 18:75532246-75532268 ATGTGGTGGGGGATGCAGGTTGG - Intergenic
1160872155 19:1282436-1282458 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1160872180 19:1282497-1282519 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1162145166 19:8608899-8608921 ATGGGGTAGGGGGAGGAGGGGGG + Intronic
1163130191 19:15267627-15267649 ATGTTTTGGGGGCAGGGGGTGGG - Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164390302 19:27814027-27814049 AGCTGTTGGGGGATGGAGGTGGG - Intergenic
1165581740 19:36871269-36871291 ATGTAATGGGGTAAGGAGGTGGG - Intronic
1166096211 19:40541146-40541168 AGGTTTTAGAGGAAGGAGTTGGG + Intronic
1166413827 19:42577258-42577280 AAGTGTAATGGGAAGGAAGTAGG - Intergenic
1168629213 19:57944111-57944133 ATGTGTGAGGGGAAGGATTATGG - Intronic
925038935 2:715192-715214 ATGTGTTAGTGTTTGGAGGTGGG - Intergenic
925343965 2:3156940-3156962 ATGTGTTGGGGGAGGGCCGTGGG - Intergenic
925826439 2:7852725-7852747 ATGTGTGAGTGGGAGGGGGTAGG - Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926238319 2:11066804-11066826 ATGGGATGGGGGAAGGAGGGAGG - Intergenic
926383580 2:12314794-12314816 ATGAGTTAGTGGAAGGAGCATGG - Intergenic
926548354 2:14270256-14270278 ATGTCTTGGGTCAAGGAGGTTGG + Intergenic
926695503 2:15767727-15767749 CCATGTTAGGGGAAGGAGGGTGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
927814970 2:26207210-26207232 TTTTGTTAGGGGAAAGGGGTGGG - Intronic
927932334 2:27053050-27053072 ATGGGGAAGGGGTAGGAGGTGGG + Exonic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928395158 2:30938010-30938032 GTGTGTTATGGGAAGAATGTGGG - Intronic
928429200 2:31204020-31204042 CTGTTTTGGGGGTAGGAGGTTGG + Intronic
928599269 2:32887125-32887147 ATGATGTAGGGGAAGGAGGGAGG + Intergenic
928613976 2:33018184-33018206 ATGTGGTAGGGTAAGGGGGGTGG - Intronic
928948837 2:36796481-36796503 ATGTGGTAGGGGAAAGAGACAGG + Intronic
929439278 2:41952681-41952703 ATGTGCTGGCGGAAGGAGGCTGG - Intronic
929467039 2:42154384-42154406 AAGTGATTGGGGAAGGAGGCTGG + Intergenic
929507562 2:42540110-42540132 TTGAGTCAGGTGAAGGAGGTGGG + Intronic
929997791 2:46839833-46839855 ATGTGGTAGAAGAATGAGGTGGG + Intronic
930036900 2:47091612-47091634 AGGAGTTAGGGGAAGTGGGTGGG + Intronic
930330656 2:49979000-49979022 AAGACTTAGGGGAAGGAGGTCGG + Intronic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
932502477 2:72195475-72195497 ATGTTGTAGGAGAAGAAGGTAGG + Intronic
932539133 2:72633243-72633265 CTGGGATAGGGGTAGGAGGTTGG - Intronic
935019709 2:99218052-99218074 ATGGGGTTGGGGAAGGAAGTGGG + Intronic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
937814416 2:126235501-126235523 ATGTGTCAGGGCAAGGGAGTTGG + Intergenic
938984814 2:136564451-136564473 ATGTGAGAAGGGTAGGAGGTGGG + Intergenic
939231568 2:139432789-139432811 GTGTGTTAGGGGGTGGGGGTTGG - Intergenic
941038742 2:160597157-160597179 ACATCTTAGGGGAAGGAGGGTGG - Intergenic
941347837 2:164391808-164391830 AAGGGTTAGGGGAAAAAGGTGGG - Intergenic
942287349 2:174433574-174433596 ATGTGTTAGTATTAGGAGGTAGG + Exonic
942530521 2:176904965-176904987 ATGTGGTAGAGGAGGGAGTTGGG + Intergenic
942812555 2:180016082-180016104 ATTTTGTAGGGGAAGGAAGTAGG + Intergenic
943040489 2:182798754-182798776 ATCTGTTGGGGGCGGGAGGTGGG - Intergenic
943573532 2:189602882-189602904 ATTTGAAAGGAGAAGGAGGTTGG - Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
946379174 2:219332801-219332823 AGGCGGTAGGGGAAGGAGCTGGG - Intronic
946807207 2:223482816-223482838 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
947796605 2:232897121-232897143 ATGGGGTAGGGGGTGGAGGTGGG + Intronic
948487539 2:238290284-238290306 ATGTGTTAGGGAGAGGGGGCGGG - Intergenic
1168988475 20:2072565-2072587 ATGTGTTAGAGAAAAGAGGCTGG + Intergenic
1169029894 20:2398826-2398848 ATGTGGTAGAGGGAGGTGGTGGG - Intronic
1170026421 20:11893008-11893030 ATGTGTTTGGGCAGGGAAGTAGG - Intronic
1170385193 20:15808806-15808828 ATGTGTTAGGGTAGGGATATTGG - Intronic
1172200974 20:33125764-33125786 AGGGGTTAGTGGATGGAGGTTGG - Intergenic
1172416709 20:34775035-34775057 ATGAACTAGGGGAAGGGGGTTGG + Intronic
1172916039 20:38444567-38444589 ATGTGGTAGGGGTTGGAGGGTGG - Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173234408 20:41231387-41231409 ATGTGTGAAGGCAAGGAGGCTGG - Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1175388388 20:58611542-58611564 AGGTGCCAGGGGAGGGAGGTGGG + Intergenic
1178433572 21:32537337-32537359 ATGGGTTGGGGGTAGGGGGTGGG + Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1179460314 21:41530170-41530192 ATTTCTCAGGAGAAGGAGGTGGG - Intronic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183154959 22:36067676-36067698 ATGTATTTGGGGAGGGGGGTGGG - Intergenic
1183243860 22:36678594-36678616 ATGTGCTGGGGGAAGGATGGAGG - Intronic
1183453809 22:37910728-37910750 AAGTGTTGGGGGCAGGAGGAGGG + Intronic
1183501131 22:38180097-38180119 GTGTGCTGGGGGAAGTAGGTAGG - Intronic
1183716468 22:39536094-39536116 ATGGGCTAGGGGAGGGAGGGCGG - Intergenic
949809717 3:7993184-7993206 ATGTGTTAGGAAAAGGATGGGGG - Intergenic
949838981 3:8300024-8300046 ATGTGTTAGGGCTGGGAGGAGGG - Intergenic
949905490 3:8855144-8855166 ATGTGTGAGTGGAAGAAGGGAGG - Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950572390 3:13809467-13809489 ATGGCAGAGGGGAAGGAGGTGGG + Intergenic
950903689 3:16518512-16518534 AGGTGTGATGGGAAGTAGGTGGG - Intergenic
951480245 3:23153229-23153251 ATGTGATAGTGTTAGGAGGTGGG - Intergenic
951581236 3:24166047-24166069 ATGTGTCATGGGAAGATGGTTGG - Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954971118 3:54652531-54652553 ATGTGTGAGGGAGAGGAGCTGGG + Intronic
955600667 3:60641983-60642005 GTGGGTTAGGGGTAGGGGGTGGG + Intronic
955770362 3:62378809-62378831 ATGTGATAGCGGAGGGAGTTGGG - Intergenic
958564180 3:95786504-95786526 GTGGGGTGGGGGAAGGAGGTAGG + Intergenic
959471079 3:106750967-106750989 ATGGGGTGGGGGCAGGAGGTTGG + Intergenic
961569042 3:127785189-127785211 AGGTGTGTGGGGAAGGAGGGGGG - Intronic
964178592 3:153856364-153856386 TAGTGTGAGGGGAAGCAGGTAGG - Intergenic
964647531 3:158974231-158974253 ATGTGTTGTGGGGAGGAGGCTGG - Intronic
964655854 3:159065358-159065380 ATGTGGTAGTGAAAGTAGGTAGG + Intronic
964796297 3:160501321-160501343 TTGGGTGGGGGGAAGGAGGTGGG + Exonic
965635231 3:170773913-170773935 ATGTAGTGGGGGAAAGAGGTTGG + Intronic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
966941879 3:184753043-184753065 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966941885 3:184753072-184753094 AGGTGTTGGGAGAAGGTGGTAGG + Intergenic
966941898 3:184753130-184753152 AGGTGTTGGGAGAAGGTGGTAGG + Intergenic
966941938 3:184753294-184753316 AGGTGTTGGGAGAAGGTGGTAGG + Intergenic
966941983 3:184753475-184753497 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942014 3:184753588-184753610 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942020 3:184753617-184753639 AGGTGTTGGGAGAAGGTGGTAGG + Intergenic
966942060 3:184753783-184753805 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942092 3:184753909-184753931 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942122 3:184754019-184754041 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942147 3:184754116-184754138 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942202 3:184754332-184754354 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966942249 3:184754516-184754538 AGGTGTTGGGAGAAGGTGGTGGG + Intergenic
966948976 3:184798602-184798624 ATGTGTTCAGGGAAAGAAGTTGG - Intergenic
967328295 3:188264566-188264588 ATGAGGTAGGGGAGGGAGGTGGG + Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968252247 3:197230396-197230418 ATGTGACAGGTGAAGGAGTTTGG - Intronic
969612510 4:8235334-8235356 GTGTGTGAGAGGAAGGAGGCTGG + Intronic
970555997 4:17232963-17232985 ATCTGTTGGGAGAAGGAGGTTGG - Intergenic
970895035 4:21092581-21092603 ATGTGGTTGGGGATGCAGGTGGG - Intronic
971077486 4:23166786-23166808 ATGTGTTAGGGAGAGAAGGGGGG - Intergenic
972891198 4:43558037-43558059 ATCTGTTGTGGGATGGAGGTTGG + Intergenic
973720094 4:53714715-53714737 ATGTGTTGGGGGAATGAGTAGGG + Intronic
974514970 4:62897213-62897235 ATGAGTTCAGGGAAGGAGGCTGG + Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
977170316 4:93753485-93753507 ATGGGGTAGGGGGAGGAGGGAGG - Intronic
977973455 4:103237425-103237447 AGGTGTTAGGGATGGGAGGTTGG + Intergenic
977986810 4:103392185-103392207 AGGTGTTAGGGATGGGAGGTTGG - Intergenic
978393382 4:108251216-108251238 ATGGGGTGGGGGAAGGAGGGAGG + Intergenic
979920134 4:126486542-126486564 ATGTGTATGGGGATAGAGGTTGG + Intergenic
980947530 4:139337275-139337297 ATGTGATAGTGGTAGGTGGTGGG + Intronic
981028431 4:140099744-140099766 GTGTGTTGGGGAAGGGAGGTTGG - Intronic
981936476 4:150245509-150245531 ATGGGGTAGGGGAAGGGGGAGGG - Intronic
982173637 4:152684721-152684743 TTGGGTTAGGGGGAGGAGGAAGG - Intergenic
982495985 4:156092475-156092497 ATGGCATAGGGCAAGGAGGTTGG + Intergenic
983112731 4:163772916-163772938 ATATGGAAGGAGAAGGAGGTGGG + Intronic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983918298 4:173315842-173315864 ATGGGTTGGGGGGAGGAGATAGG - Intronic
984519604 4:180786123-180786145 ATGTGTTACGGGAGGCAGGGAGG + Intergenic
985542208 5:492354-492376 ATGGGGGAGGGGAGGGAGGTAGG + Intronic
985590321 5:761236-761258 ATGTGCTAGAGCAGGGAGGTGGG + Intronic
985970398 5:3373603-3373625 ATGTGTTGTGGGATGGAGGCTGG + Intergenic
986130393 5:4924546-4924568 ATGTGTAAAGGGAAGAGGGTGGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987627306 5:20418826-20418848 ATGTGATAGTGTTAGGAGGTGGG + Intronic
987659195 5:20850423-20850445 GTATGTTATGGGTAGGAGGTGGG + Intergenic
988184466 5:27842104-27842126 ATGTTTTCTGGGAAAGAGGTAGG - Intergenic
988764474 5:34355554-34355576 GTATGTTATGGGTAGGAGGTGGG - Intergenic
989347100 5:40441309-40441331 ATGTGTTACGGATAAGAGGTTGG + Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
992416626 5:76558292-76558314 ATGTGTGAGGGGTAGGGGCTGGG - Intronic
992615327 5:78541570-78541592 AAGATTTTGGGGAAGGAGGTGGG + Intronic
993829050 5:92730679-92730701 ATTAGTTAGGGGAAGCAGCTGGG - Intergenic
995008180 5:107226742-107226764 ATCTGTTAGAGGATGGAGCTAGG - Intergenic
996448738 5:123592292-123592314 ATTTGTTTGGAGCAGGAGGTAGG + Intronic
996904531 5:128583157-128583179 ATGGGTTTGGGGAAGCAGGAAGG - Intronic
997549527 5:134739507-134739529 ATGTGTTTGGGGGAGGAAGGAGG - Intronic
997602944 5:135152693-135152715 GTGTGTTGGTGGAAGGAGTTGGG + Intronic
997652079 5:135529674-135529696 ATGTGTTGTGGGAGGGACGTGGG + Intergenic
997658506 5:135572906-135572928 TTGTTTCAGGGGAGGGAGGTGGG + Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
997860187 5:137409002-137409024 GTGTGTTTGGGGAAGGGGTTTGG - Intronic
999885810 5:155921381-155921403 AGGTCTTAGGGGAAGGAGATGGG + Intronic
999897551 5:156051848-156051870 GTGTGCTGGGGGAAAGAGGTGGG + Intronic
1000157808 5:158568969-158568991 ATGTGTTGGGGGAGGGACCTGGG + Intergenic
1001461636 5:171920364-171920386 ATATGTTCGGTGAAGGAGGATGG + Intronic
1001891714 5:175344784-175344806 AGGAGTGGGGGGAAGGAGGTGGG + Intergenic
1001914701 5:175549817-175549839 ATGTGTTTGTGGGAGGAGTTGGG - Intergenic
1003422881 6:5974044-5974066 ATGCATTGGGGGAAGGGGGTGGG - Intergenic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1003858686 6:10301679-10301701 ATTTTTGAGGGGCAGGAGGTGGG - Intergenic
1004074296 6:12330965-12330987 ATTTCTTTGGGGAATGAGGTTGG + Intergenic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005763173 6:28986337-28986359 ATGGGGTGGGGGTAGGAGGTTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006784769 6:36658930-36658952 ATGTGATAGTGTAAGGAGGTGGG + Intergenic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1006817612 6:36863386-36863408 GTGTCTTAGGGAAGGGAGGTGGG - Intronic
1007094388 6:39204437-39204459 ATGTGCTATGGAGAGGAGGTAGG - Intronic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1007480618 6:42147385-42147407 ATTTGTCAAGGGCAGGAGGTAGG + Intergenic
1007947305 6:45838095-45838117 ATGTGTTAGGGGTGGGAATTAGG - Intergenic
1008375828 6:50790331-50790353 GTGTGAGAGGGGAAGGAGGTGGG - Intergenic
1008950811 6:57156804-57156826 ATGGATTGGGGGCAGGAGGTGGG + Intronic
1009544910 6:65009191-65009213 CTTTGGTAGGGAAAGGAGGTGGG - Intronic
1010090495 6:71974553-71974575 ATATGTTAGGGGGACCAGGTAGG + Intronic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1011242978 6:85291892-85291914 TTGGGTAGGGGGAAGGAGGTGGG - Intergenic
1012334755 6:98041414-98041436 CTGTGTTAGGGGTTGGAGCTGGG - Intergenic
1012609191 6:101194445-101194467 ATGTGGTCGGGGAAGGGGGGAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014453049 6:121604051-121604073 ATGTGATAGTAGCAGGAGGTGGG - Intergenic
1014556417 6:122846211-122846233 TTGGGGTAGGGGTAGGAGGTGGG - Intergenic
1015175039 6:130296930-130296952 AAGTGTCAGGGGAAGGGGCTGGG - Intronic
1015326981 6:131934176-131934198 ATGTACAAGAGGAAGGAGGTGGG + Intergenic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1015988560 6:138911656-138911678 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988569 6:138911699-138911721 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1015988578 6:138911742-138911764 ATGTGTGAGGGAGAGGAGGATGG + Intronic
1015988588 6:138911785-138911807 ATGTGTGAGGGAGAGGAGGAGGG + Intronic
1015988602 6:138911874-138911896 ATGTGTGAGGGAGAGGAGGACGG + Intronic
1017483270 6:154879478-154879500 ATGTGTTAAGGATATGAGGTTGG - Intronic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1018570433 6:165204137-165204159 ATGTGTTGAGGGAGGGAGGGAGG - Intergenic
1018842958 6:167531789-167531811 AAGTGATATGGGAAGGAGGCAGG + Intergenic
1019102297 6:169641237-169641259 ATGTGTTTGGGGCTGGAGCTCGG - Intronic
1019784513 7:2966761-2966783 ATGTGACATGGGGAGGAGGTAGG - Intronic
1021777970 7:24072476-24072498 ATGGGCTGGGGGAAGGAGGCTGG + Intergenic
1021857606 7:24872486-24872508 TGGTGTTGGGGGAAGGAAGTTGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022543342 7:31160311-31160333 ATGTGGGAGGGGTGGGAGGTGGG - Intergenic
1024086939 7:45901421-45901443 TAGTTGTAGGGGAAGGAGGTGGG + Intergenic
1024702847 7:51923577-51923599 ATGTCTTAGGAGAAGTAGTTAGG + Intergenic
1025764948 7:64435333-64435355 AGGAGTGAGGGGAAGCAGGTAGG - Intergenic
1026047841 7:66919999-66920021 AAGTGTTAGGGGAATGGGATGGG - Intergenic
1026479320 7:70764658-70764680 AGGGTTTAGGGGAAGGAGGTAGG + Intronic
1027190468 7:75993373-75993395 AGGTGCTAGGGGAAGGGAGTGGG - Intronic
1027481734 7:78706191-78706213 ATGTGTTATGGGAGGGATCTGGG + Intronic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1028046723 7:86129843-86129865 ATGTGTTAGTGGATTGAAGTTGG - Intergenic
1029976170 7:104836271-104836293 ATATGTCAGGGAAAGGAGCTTGG + Intronic
1030832514 7:114243097-114243119 ATTTCTTAGGGGATTGAGGTGGG + Intronic
1030861790 7:114640672-114640694 ATGTGTGGGGTGAAGCAGGTTGG - Intronic
1031464407 7:122090930-122090952 AGGGGTTGGGGGAAGGAGGATGG - Intronic
1031784521 7:126012786-126012808 TTGTGTTTGGGGAATAAGGTGGG + Intergenic
1032331754 7:130987023-130987045 GTGTGTTGGGGGTGGGAGGTGGG + Intergenic
1033207517 7:139435711-139435733 TCGTGTTAAGGGAAGGAAGTCGG - Intergenic
1033281118 7:140007214-140007236 AGGGGGTAGGGGTAGGAGGTGGG - Intronic
1035931780 8:3787917-3787939 AGTTGTGAGGGGAAGGAGATGGG + Intronic
1037621595 8:20568063-20568085 CTGTGTTAGGGGAAGCAACTGGG + Intergenic
1037807990 8:22069111-22069133 ATGTGTGAGGGGAGGGAGTTAGG - Intronic
1038046264 8:23767969-23767991 AAGTGTGTGGGGAAGGAAGTAGG + Intergenic
1039210179 8:35204726-35204748 ATGAGCTCAGGGAAGGAGGTGGG - Intergenic
1039218637 8:35302076-35302098 AGGTGCTGGGGGAAGGAGGGAGG + Intronic
1039448955 8:37655824-37655846 ATGTGTGAGGGGTGGGAAGTGGG + Intergenic
1041311548 8:56522641-56522663 AAGTGTTAGGCCAAGGAGGGTGG - Intergenic
1041348858 8:56929171-56929193 AAGTGGTAGGGTAAGCAGGTTGG - Intergenic
1041734468 8:61095269-61095291 GTTTTTTAGGGGCAGGAGGTAGG + Intronic
1041928926 8:63266639-63266661 ATGTGGCTGGGGAAGGAAGTAGG - Intergenic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1043050239 8:75377049-75377071 ATGGGTTGGGGGAAGGGGGTGGG - Intergenic
1043632570 8:82354648-82354670 ATGTTTTAGGAAATGGAGGTGGG + Intergenic
1044192504 8:89335697-89335719 CTGGGTCAGGGGAGGGAGGTGGG - Intergenic
1044642929 8:94404072-94404094 ATGTGTAATGGGAATGAGGTAGG - Exonic
1044704640 8:94996654-94996676 ATGAATTGGGGGAAGGCGGTGGG - Intronic
1044941862 8:97351690-97351712 ATGTGTTTGGTAAGGGAGGTTGG + Intergenic
1045054671 8:98358693-98358715 ATGGTTTAGGGGAATGAGGGGGG + Intergenic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046218346 8:111179830-111179852 ATGGGGTAGGGGAAGGGGGGAGG - Intergenic
1046560531 8:115831839-115831861 ATGTGTGATGGGGTGGAGGTTGG - Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1048266946 8:132995660-132995682 TTGTGTTTGGGGAAGTTGGTGGG + Intronic
1048299028 8:133238064-133238086 ATGTATCAGGGGTGGGAGGTTGG + Exonic
1048340775 8:133537042-133537064 TTGTGTTTGGGGTAGGAGTTGGG - Intronic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048707427 8:137169483-137169505 CTGTGTTTGTGGAACGAGGTTGG + Intergenic
1048774605 8:137932059-137932081 ATGTGTAAGGGAAAGGAAGCAGG - Intergenic
1049283213 8:141761093-141761115 CTGTGTTTGGGGACAGAGGTGGG - Intergenic
1049505559 8:142994639-142994661 CAGTTTTAGGGGAAGGAGTTGGG + Intergenic
1050081222 9:1917866-1917888 ATGTGTTCATGGAAGGGGGTGGG - Intergenic
1050778570 9:9300533-9300555 ATGTGTTGGTAGTAGGAGGTTGG + Intronic
1050833792 9:10050200-10050222 ATGTTTCAGGGGCAGTAGGTGGG + Intronic
1051509147 9:17858153-17858175 TTATTTTAGGGGATGGAGGTGGG + Intergenic
1052135055 9:24898847-24898869 ATGTGGTAGGGGCAGGAGCAAGG + Intergenic
1052171096 9:25397485-25397507 ATGTGAAAGTGGAACGAGGTAGG - Intergenic
1052549645 9:29931654-29931676 CTGACTTAGGGGAAAGAGGTAGG + Intergenic
1052688251 9:31780952-31780974 ATGTGCTAGGGCAATGAGGAAGG - Intergenic
1053264054 9:36697606-36697628 ATGTGGTAGGGGCAGAAGCTTGG + Intergenic
1054459143 9:65453312-65453334 ATGGGTAAAGGGAAGGATGTGGG + Intergenic
1054800658 9:69345154-69345176 AAGTGTCAGGTGAAGGAGGCTGG + Intronic
1055273598 9:74589354-74589376 GTGTGTTGGGGGAGAGAGGTGGG - Intronic
1055716711 9:79126141-79126163 ATGTGGTAGTCTAAGGAGGTGGG + Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1057036602 9:91816227-91816249 ATGTGGTAGAGCATGGAGGTGGG - Intronic
1057106302 9:92420971-92420993 ATGTGTTTGGGAAATGTGGTTGG + Intronic
1057828665 9:98390669-98390691 AGGTGTTTGGGGAAGGATGATGG - Intronic
1058396275 9:104557504-104557526 AGGTGTCAGGGGAATGAAGTGGG - Intergenic
1058811202 9:108641259-108641281 ATGTGTTAGTGGGTGGAGGCAGG - Intergenic
1059165718 9:112074643-112074665 ATGTGTTAGGCTAAGGATTTGGG - Intronic
1059819185 9:117952771-117952793 ATGTGCTTTGGGGAGGAGGTTGG + Intergenic
1059949671 9:119449155-119449177 ATGTGATAGGATTAGGAGGTGGG + Intergenic
1061471630 9:130831339-130831361 GTGTGTCAAGGGAAGGAGGCAGG - Intronic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186568489 X:10689768-10689790 ATGTGTAAGGAGAAGGAAATTGG - Intronic
1186705218 X:12133649-12133671 ATGGGTTAGATGTAGGAGGTGGG - Intergenic
1187138735 X:16573102-16573124 GCCTGTTAGGGGTAGGAGGTGGG + Intergenic
1187596425 X:20777552-20777574 ATGGGGTAGGGGAAGGGGGGCGG + Intergenic
1188307036 X:28571440-28571462 ATGTAGTAGGGCAAGGAGCTGGG + Intergenic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1189240201 X:39518994-39519016 CTGTGTCACGGGCAGGAGGTCGG - Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1190323359 X:49191441-49191463 ATCTGATTGGAGAAGGAGGTGGG + Exonic
1191782552 X:64884523-64884545 ATGGGGTGGGGGAAGGAGGGAGG + Intergenic
1192452376 X:71252451-71252473 ATGTGTGTGGGGAAGGACTTGGG - Intronic
1192588685 X:72341290-72341312 ATGTGTCAGGGGATGAGGGTGGG + Intronic
1193052883 X:77119924-77119946 ATGTTTTAGGGGTGGGAGGTAGG + Intergenic
1194706960 X:97187229-97187251 ATGTATTAGAGGAAGGAGTAGGG + Intronic
1194972202 X:100356483-100356505 ATGTGTTGGGGGTAGGAAGTAGG - Intronic
1195487932 X:105431568-105431590 ATGTTTTAAGGGAAGAAGCTTGG - Intronic
1195967141 X:110439057-110439079 CAGTGTTAGGGGAAGAGGGTAGG + Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1198531365 X:137551683-137551705 GTGTGTTTGGGGCAGGGGGTGGG + Intergenic
1199457919 X:148050201-148050223 GTGTGTTTGGGGAAAGATGTTGG - Intergenic
1199585858 X:149415180-149415202 TTGTGTTCGAGGAAGGAGATAGG + Intergenic
1199688076 X:150281953-150281975 ATGTGGTTGGGGAAGAAGGCAGG - Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199860234 X:151794847-151794869 ATGAGTGAGGGAAAGGAGCTGGG - Intergenic
1201293286 Y:12442407-12442429 CTGGGTTAGGTGAGGGAGGTAGG - Intergenic
1201469293 Y:14316371-14316393 ATGTGTTATGGGATGGAAGTAGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic
1201790316 Y:17832590-17832612 TTGTGTGTGGGGAAGGACGTTGG - Intergenic
1201811238 Y:18073399-18073421 TTGTGTGTGGGGAAGGACGTTGG + Intergenic
1202031200 Y:20576003-20576025 CTGTGTTCGGGAAAGGAGCTGGG + Intronic
1202518816 Y:25667778-25667800 TTGTGTGTGGGGAAGGACGTTGG + Intergenic