ID: 1083048275

View in Genome Browser
Species Human (GRCh38)
Location 11:59755469-59755491
Sequence CTGGAGGCGCAGGCGGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 670
Summary {0: 1, 1: 0, 2: 16, 3: 66, 4: 587}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083048275_1083048290 13 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048290 11:59755505-59755527 GCGGGCCCGGCCGCCGCTTCCGG 0: 1
1: 0
2: 1
3: 19
4: 185
1083048275_1083048282 -6 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048282 11:59755486-59755508 CTCCAGCTCCTTCGCCCCGGCGG 0: 1
1: 0
2: 1
3: 12
4: 177
1083048275_1083048280 -9 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048280 11:59755483-59755505 CGCCTCCAGCTCCTTCGCCCCGG 0: 1
1: 0
2: 1
3: 25
4: 289
1083048275_1083048294 25 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048294 11:59755517-59755539 GCCGCTTCCGGCAGCTCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 111
1083048275_1083048296 26 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048296 11:59755518-59755540 CCGCTTCCGGCAGCTCACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1083048275_1083048285 0 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048285 11:59755492-59755514 CTCCTTCGCCCCGGCGGGCCCGG 0: 1
1: 0
2: 2
3: 19
4: 145
1083048275_1083048283 -5 Left 1083048275 11:59755469-59755491 CCCGCCGCCGCCTGCGCCTCCAG 0: 1
1: 0
2: 16
3: 66
4: 587
Right 1083048283 11:59755487-59755509 TCCAGCTCCTTCGCCCCGGCGGG 0: 1
1: 0
2: 5
3: 113
4: 3716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083048275 Original CRISPR CTGGAGGCGCAGGCGGCGGC GGG (reversed) Exonic
900106082 1:981693-981715 CAGGAGGTGCAGGCTGCGGTGGG + Intronic
900189983 1:1349223-1349245 CGGGAGCCGGGGGCGGCGGCCGG - Intronic
900264549 1:1750643-1750665 CTGGAGGCGCAGGTGTCCACAGG + Intergenic
900349667 1:2228492-2228514 CGGGGGGCCCGGGCGGCGGCGGG + Intergenic
900364111 1:2303817-2303839 CTGGAGGGGCAGGCGGGTGTCGG - Intronic
900393509 1:2443861-2443883 CGGGAGGCGCAGTCAGCGGCCGG - Intronic
900435545 1:2629036-2629058 GCGGAGGCGGAGGCGGAGGCGGG + Intronic
900538491 1:3190920-3190942 CTGAAGGCCCAGCCGGGGGCAGG - Intronic
900633466 1:3650972-3650994 CTAGAGGCGCCGGCGGGGCCTGG - Intronic
901422900 1:9162791-9162813 CTGGAGGGGCAGGTGGCATCAGG + Intergenic
901629732 1:10642230-10642252 ATGGAGTCGCTGGCGGCTGCGGG + Intronic
901633062 1:10657252-10657274 CTGGCGGTGGCGGCGGCGGCTGG - Intronic
901660310 1:10794904-10794926 CTGGGGCCGCTGGCGGGGGCTGG - Intronic
901701490 1:11046945-11046967 GTAGAGGCGCAGGCGGTAGCCGG + Exonic
901704233 1:11061212-11061234 TGGGAGGCGGAGGCGGAGGCGGG + Intergenic
903251230 1:22054287-22054309 CGGGAGGCGGAGGCTGCGGTGGG - Intronic
903440901 1:23387228-23387250 CCGGAGGTGCAGGAGGCCGCAGG - Intronic
903612302 1:24624689-24624711 CGGGAGGCGGAGGCTGAGGCAGG - Intergenic
903700621 1:25245990-25246012 GGGGAGGCGGAGGCGGAGGCGGG - Intronic
904014641 1:27410046-27410068 TTGGAGGCGGAGGTGGCGGAGGG + Exonic
904039291 1:27575173-27575195 CCAGAGGCGGCGGCGGCGGCGGG - Intronic
904756170 1:32770011-32770033 CTGGAGGCGGAGGCGGAGGCTGG + Exonic
904783040 1:32964760-32964782 GTGGCGGCGTCGGCGGCGGCCGG - Intergenic
904822936 1:33256793-33256815 CCCGAGGCGCAGGCGGCCCCGGG - Intronic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905752365 1:40477261-40477283 CTGTGGGCGGAGCCGGCGGCCGG + Exonic
905777601 1:40679230-40679252 CTGGAGGCTCTGGCAGCAGCTGG - Intergenic
906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG + Exonic
906496941 1:46311331-46311353 GCGGAGGCGGAGGCGGAGGCGGG + Intronic
906678720 1:47710685-47710707 CCGGAGGCGCAGGCGGCTGCTGG + Intergenic
907297483 1:53464675-53464697 GTGGCGGCGGCGGCGGCGGCAGG - Exonic
907416146 1:54315311-54315333 GAGGAGGGACAGGCGGCGGCTGG - Intronic
908132171 1:61083757-61083779 GTGGTGGCGGCGGCGGCGGCGGG - Intronic
908581893 1:65525485-65525507 CAGGTGGCGGGGGCGGCGGCGGG - Intronic
909638108 1:77840564-77840586 TAGGAGGCGGAGGCGGAGGCGGG + Intronic
909958072 1:81802315-81802337 CTGGAGGCGCAGGGAGCCGCGGG + Intronic
910338226 1:86156686-86156708 CTCGGGGCGCCGGCGGCAGCGGG + Exonic
910916870 1:92298946-92298968 CCGGAGGAGGTGGCGGCGGCTGG - Exonic
911498830 1:98661690-98661712 CTGGCGGCGGCGGTGGCGGCCGG + Intronic
911527560 1:99004813-99004835 CTGGAGGAAGAGGCGGAGGCAGG + Exonic
912117520 1:106425262-106425284 ATGGTGGTGCAGGCGGCAGCAGG + Intergenic
912513026 1:110201315-110201337 CTGGAGGAGCAGGAGGTAGCAGG + Exonic
912685135 1:111756144-111756166 CTGGAGGGGCTGCGGGCGGCCGG + Exonic
914433742 1:147641849-147641871 CGGGAAGGGCAGGCGGAGGCGGG + Intronic
914713237 1:150234195-150234217 CTGGCGGGGGAGGCGGGGGCGGG + Intronic
914748385 1:150515678-150515700 CAGGAGGCCCAGGCGGCCCCGGG - Intergenic
915740196 1:158113441-158113463 CGGCAGGCGCGGGCGGCGGGTGG + Intergenic
917846695 1:179026020-179026042 CCGGAGGCGGCGGGGGCGGCCGG + Exonic
917974407 1:180229940-180229962 GCGGAGGCGGAGGCGGAGGCGGG + Intergenic
919775330 1:201190726-201190748 CTGGAGGAGAAGGAGGAGGCGGG + Intergenic
919976948 1:202619053-202619075 CTGGAGGCGGAGGAGGCTGCTGG - Intronic
919978875 1:202630113-202630135 CTGGAGGGGCAGGCAGGGGCTGG + Intronic
920382516 1:205543601-205543623 CTGGGAGCGCATGCGGGGGCGGG + Intergenic
920511809 1:206557324-206557346 CTGCAGGCGCAGGCGGCGCGGGG + Intronic
922314806 1:224433903-224433925 CTGGCGGCGGAGGGGGCGGAAGG + Exonic
922314840 1:224434034-224434056 GTGGAGGAGGAGGGGGCGGCGGG - Exonic
922783829 1:228273310-228273332 AGGGAGGTGCAGGCGGAGGCGGG + Exonic
922958586 1:229625909-229625931 CCGGAGGCGGCGGCGGCGGGGGG - Exonic
923451300 1:234120030-234120052 CTGGAGGTGCAGGCTGCAGAAGG + Intronic
923611993 1:235504155-235504177 CCGGAGGCGCAGGCGGGCGGCGG + Exonic
924052340 1:240091998-240092020 CGGGAGAGTCAGGCGGCGGCGGG - Exonic
924436682 1:244048904-244048926 CCGGCGGCGGCGGCGGCGGCCGG + Intergenic
1063380759 10:5584081-5584103 GTGGAGGCGCAGGCGCAGGCTGG - Intergenic
1063459113 10:6204119-6204141 CTGGTGGCGGGGGCGGCGACCGG - Intronic
1063504135 10:6580526-6580548 CTGGAGCGGGAGGCGGCGGCCGG + Intergenic
1063995052 10:11611395-11611417 CGTGAGGGGCCGGCGGCGGCGGG - Intronic
1064203006 10:13300093-13300115 CTGGAGGCGGAGCCGCCCGCTGG - Exonic
1064209079 10:13348112-13348134 CCGGCGGCGGCGGCGGCGGCGGG + Exonic
1065140472 10:22714453-22714475 CTGAGCGCGCCGGCGGCGGCGGG - Exonic
1065520570 10:26567284-26567306 CGGGCGGCGGCGGCGGCGGCGGG - Exonic
1066308053 10:34166510-34166532 CAGGAGGCTAAGGCGGGGGCAGG + Intronic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1068204176 10:53827433-53827455 GCGGAGGCGGCGGCGGCGGCGGG + Exonic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1070327923 10:75400093-75400115 GTGGAGGCGGTGGCGGTGGCGGG - Exonic
1070835922 10:79446678-79446700 GCGGAGGCGGAGGCGGGGGCGGG - Intergenic
1070842108 10:79494538-79494560 CAGGAGGAGCAGGTGGTGGCTGG - Intergenic
1071997514 10:91162866-91162888 GCGGCGGCGCTGGCGGCGGCGGG - Intergenic
1072699927 10:97633319-97633341 CTGGAGGCGCAGGAGGGAGGGGG - Intronic
1072789642 10:98308925-98308947 CCGGCGGCGCAGGGGGAGGCAGG + Intergenic
1073058259 10:100715701-100715723 CAGACGGCGCCGGCGGCGGCTGG - Intergenic
1073444182 10:103571126-103571148 CAGGAGGCGGGGGCGGGGGCAGG - Intronic
1073498814 10:103918108-103918130 CTGGAGCTGCAGGCGGCGGGAGG - Exonic
1074618472 10:115093442-115093464 CGGGAGGCGCAGACTGCGCCCGG - Intronic
1074776291 10:116770524-116770546 CAGGTGGCACAGGGGGCGGCAGG + Intergenic
1075032095 10:119030300-119030322 GTGGCGGCGGCGGCGGCGGCGGG - Exonic
1075207018 10:120456995-120457017 CAGGAGGCGGAGGCGGCTCCTGG + Exonic
1075334486 10:121598447-121598469 GCGGCGGCGCGGGCGGCGGCTGG - Intronic
1075645469 10:124093344-124093366 CAGGCAGCGCCGGCGGCGGCCGG - Intronic
1076241842 10:128914768-128914790 CCGGAGCAGCAGGCGGTGGCTGG + Intergenic
1076404622 10:130203735-130203757 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404630 10:130203754-130203776 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076404638 10:130203773-130203795 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1076765490 10:132630790-132630812 CGGGAGGCGGCGGGGGCGGCGGG + Intronic
1076806793 10:132862800-132862822 CTGGAGGGGGACGGGGCGGCCGG + Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077048278 11:555599-555621 CTGGAGGACCAGGGGGCGGCCGG + Intronic
1077060484 11:615768-615790 AGGGAGGCGGAGGCGGAGGCGGG - Intronic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077143507 11:1035038-1035060 CTGGACGAGCACGAGGCGGCAGG + Intronic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077323579 11:1953595-1953617 GGGGAGGCCCAGGAGGCGGCCGG - Intronic
1077404623 11:2377529-2377551 ATGGCGGCGCGGGCGGCGGGCGG - Exonic
1077419741 11:2444737-2444759 GCGGGGGCGCAGGCGGGGGCGGG + Intronic
1077539329 11:3139227-3139249 CTGGAGGAGCAGGTGGCCACCGG + Intronic
1079064182 11:17275684-17275706 CAGGAGGCGGAGGCAGAGGCGGG - Intronic
1079237103 11:18698866-18698888 ATGGCGGCGGCGGCGGCGGCTGG - Exonic
1080036682 11:27719130-27719152 CCGGGGGTGCAGGCGGGGGCGGG + Intronic
1081636696 11:44726784-44726806 TTGGAGGAGGAGGCGGAGGCTGG + Intronic
1082996889 11:59262159-59262181 CTGGTGCTGCAGGCGGGGGCTGG - Intergenic
1083048275 11:59755469-59755491 CTGGAGGCGCAGGCGGCGGCGGG - Exonic
1083615098 11:64022215-64022237 CTGGGGGCACAGGCAGTGGCAGG + Intronic
1083679590 11:64344984-64345006 GTGGAGGCGCTGGCAGCAGCGGG + Exonic
1083680342 11:64348841-64348863 CTGGGGGGGCAGGGGGCGCCAGG - Intronic
1083753715 11:64778131-64778153 GTGGAGGCGGCGGCGGCTGCTGG + Exonic
1083842807 11:65314641-65314663 CGGGTGGCGCAGGCGGCCTCCGG - Intergenic
1084126087 11:67099941-67099963 TTGGAGGCAGAGGAGGCGGCAGG + Intergenic
1084190265 11:67495452-67495474 CTGGTGGTGCTGGGGGCGGCTGG + Exonic
1084611137 11:70203703-70203725 TTCGAGGCGGGGGCGGCGGCCGG + Exonic
1085076763 11:73598279-73598301 CGGGAGGCGCAGGCCGCGCGCGG - Intergenic
1088595343 11:111436774-111436796 CTGGAGGGGCAGGCGCGGGAAGG - Intronic
1089494985 11:118903298-118903320 CTGGGGGCGGGGGCGGGGGCGGG - Exonic
1089559351 11:119335992-119336014 CTGGAGCCGCAGTCTGCAGCTGG + Exonic
1089581422 11:119483967-119483989 CTAGAGCCGCAGGAGGCGGGAGG - Intergenic
1090751611 11:129750841-129750863 CTGGAGGCACAGGGAGCGGCTGG + Intergenic
1091079475 11:132653372-132653394 CTGGAGGCACAAGCGCAGGCAGG - Intronic
1091273016 11:134331633-134331655 CGCGAGGCGCAGGCGGGTGCGGG - Intergenic
1091460969 12:643156-643178 CTGGAGGCTTGGGCAGCGGCAGG - Intronic
1091550231 12:1530822-1530844 GCGGGGGCGCAGGGGGCGGCCGG - Intronic
1091558680 12:1594446-1594468 CAGGAGGCGGAGGATGCGGCAGG - Intronic
1094377113 12:29801964-29801986 CTGGGGGCGCTGCAGGCGGCCGG + Intergenic
1096003133 12:48145856-48145878 CTGGAGGAGCAGGCAGTGGGTGG + Exonic
1096024708 12:48350823-48350845 GGGGAGGGGCAGGCGGCGCCCGG - Intronic
1096336944 12:50764057-50764079 CTGGGGGCGGGGGCGGGGGCGGG - Intronic
1096532489 12:52250414-52250436 CTGGAGGCAGAGGCTGCTGCTGG + Intronic
1096992637 12:55817729-55817751 CTGGAGGCGGAGGCCGCGGGTGG - Exonic
1097267799 12:57755762-57755784 GCGGCGGCGCGGGCGGCGGCAGG - Exonic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1098301122 12:69055151-69055173 CTGCAGGAGCAGGCGGGAGCTGG + Intergenic
1098426047 12:70366502-70366524 CGCGGGGCCCAGGCGGCGGCTGG + Exonic
1100565556 12:95790678-95790700 GAGGAGGCGGCGGCGGCGGCCGG - Exonic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1101680015 12:106955803-106955825 CTGGAGCCGCGGGAGGAGGCGGG + Exonic
1102003573 12:109573852-109573874 GGGGAGGCGGCGGCGGCGGCAGG + Exonic
1102454580 12:113063676-113063698 CTGGAGTGGCAGGTGGTGGCTGG + Intronic
1102471398 12:113161796-113161818 CTGGGGGCGGGGGCGGGGGCGGG - Intronic
1103200301 12:119082677-119082699 CTGGAGGCCCAGGGTGGGGCTGG - Intronic
1103433067 12:120904247-120904269 CGGGCGGCGGCGGCGGCGGCCGG + Exonic
1103778617 12:123384371-123384393 CTGGAGCCGCAAGGGGGGGCCGG - Intronic
1103848375 12:123915145-123915167 GTGGAGGCGGAGGCGGAGCCGGG - Intronic
1103856485 12:123973612-123973634 CGGGGGGCGCAGATGGCGGCCGG + Exonic
1103905450 12:124325274-124325296 ATGGAGGCGCAGGCGGACTCAGG + Exonic
1104001449 12:124863344-124863366 CTGGAGGCGCAGGCCAGGGTTGG - Intronic
1104624012 12:130338184-130338206 CGGGATGCGGGGGCGGCGGCTGG + Intronic
1104977908 12:132560387-132560409 CCGGGGGCGCACGTGGCGGCGGG + Intronic
1105472070 13:20703736-20703758 CTCGGGGCGGCGGCGGCGGCGGG + Intronic
1105578551 13:21674156-21674178 CTGGAGGCGCGCGCAGCGGCAGG + Intronic
1106478030 13:30114804-30114826 CGGGAGGCGGCGGCGGCGGCGGG + Intergenic
1107654125 13:42574399-42574421 GGTGCGGCGCAGGCGGCGGCGGG - Exonic
1107851682 13:44577480-44577502 CTGGCGGGGCAGGAGGCGGCGGG + Intergenic
1108396605 13:49996845-49996867 CCGGAGGTGCAGGCGGAGGCGGG + Intronic
1110558512 13:76886258-76886280 GTGGCGGCGGCGGCGGCGGCGGG - Exonic
1113378211 13:109783242-109783264 GGGGAGGCGCGGGCGGCGACAGG + Exonic
1113583841 13:111449191-111449213 CTGGAGGAGCAGGTAGCGCCTGG - Intergenic
1113834753 13:113321496-113321518 CTGGGCGCGCGGGCGGGGGCGGG - Intronic
1113841566 13:113364182-113364204 CTGGAGGCGGGGGCGGGGGGGGG + Intergenic
1115028431 14:28767591-28767613 GTGGTGGCGGTGGCGGCGGCGGG - Exonic
1115399145 14:32938834-32938856 GGGGAGGCGGCGGCGGCGGCGGG - Intronic
1115399364 14:32939548-32939570 CGAGAGGCTCTGGCGGCGGCCGG + Intronic
1117941592 14:60972465-60972487 ATGGCGGCGGCGGCGGCGGCGGG + Exonic
1118776961 14:68979225-68979247 CTGGCGGCGACAGCGGCGGCTGG + Exonic
1118849204 14:69571848-69571870 CTGGAGGCGCTGGCCCGGGCGGG - Exonic
1119587581 14:75850986-75851008 CAGGAGGCGGAGGTGGCGGAGGG + Intronic
1120914780 14:89701614-89701636 CCGCAGGCGCCGGCGGCGTCGGG + Intergenic
1121279389 14:92688188-92688210 GTGGTGGCGGCGGCGGCGGCGGG + Exonic
1122316353 14:100827984-100828006 CTGGGGGCGCAGGAGGCGCCTGG + Intergenic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122423324 14:101590872-101590894 CTGGAGGCACAGGCGGTGTGTGG + Intergenic
1122445038 14:101761839-101761861 CTGCGGGGGCAGGCGGCGGCAGG + Exonic
1122447707 14:101781620-101781642 CCGGAGGCTCCGGAGGCGGCCGG - Intronic
1122635335 14:103127079-103127101 CTGGCGGCGGCGGCGGCGGCGGG + Exonic
1122811902 14:104293362-104293384 CTGGAGGGCCAGGGGGCTGCAGG + Intergenic
1122891750 14:104735247-104735269 CTGGTGGGGCAGGTGGAGGCTGG - Intronic
1123684302 15:22786566-22786588 CGGGAGGCGCGGGCGGGGGAGGG - Intronic
1123898062 15:24848230-24848252 GTGGGGGCGGGGGCGGCGGCGGG + Intronic
1124327866 15:28782984-28783006 CCGGAGGCCCAGGAGGCGGGCGG - Intergenic
1124368130 15:29088370-29088392 CTGGATGCTCAGTAGGCGGCTGG - Intronic
1124492608 15:30167437-30167459 CTGGAGGCGGAGGAGGCTGCTGG - Intergenic
1124494475 15:30178000-30178022 CCGGAGGGGCAGGCAGGGGCTGG + Intergenic
1124628790 15:31325978-31326000 CTGGAGGCACAGGCCGCGGTGGG + Intergenic
1124652457 15:31483856-31483878 CGTGCGGCGCGGGCGGCGGCGGG - Exonic
1124749095 15:32360645-32360667 CCGGAGGGGCAGGCAGGGGCTGG - Intergenic
1124750926 15:32370888-32370910 CTGGAGGCGGAGGAGGCTGCTGG + Intergenic
1124789912 15:32717907-32717929 CTGGCGGCGGCGGCGGCGCCTGG + Intergenic
1124922312 15:34038912-34038934 GCGGCGGCGGAGGCGGCGGCGGG - Exonic
1125385352 15:39130929-39130951 CTGGAGGCAAAGGTGGGGGCGGG - Intergenic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125829420 15:42703435-42703457 CTGGAGGCGGAGGCTGCAGTGGG - Intronic
1126621644 15:50645912-50645934 TGGGAGGCGGAGGCGGAGGCAGG + Intronic
1129000906 15:72333045-72333067 CTGGAGGCTGAGGCAGAGGCAGG - Intronic
1129082377 15:73052356-73052378 GTGGAGCCGGAGTCGGCGGCGGG + Intronic
1130363081 15:83208144-83208166 CGGGAGGGGAAGGGGGCGGCCGG - Intergenic
1130390233 15:83447999-83448021 CTGGAGGCGCCGGTGGCCGGTGG - Intronic
1131035152 15:89217236-89217258 GTGCAGGCGCAGGCGGCCTCGGG - Exonic
1131277581 15:90994727-90994749 CGGGAGGCGCAGGCCACGCCCGG - Intronic
1132055717 15:98649169-98649191 CTGGCCGCGCGGGAGGCGGCCGG - Exonic
1132252074 15:100341680-100341702 GAGGAGGCGCGGGCCGCGGCCGG - Intronic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132902900 16:2268060-2268082 CAGGAGGAGGTGGCGGCGGCGGG - Intronic
1132931797 16:2462445-2462467 GTGGAGGTGGAGGCGGAGGCGGG + Exonic
1132950182 16:2557451-2557473 CTGGAGGCTCAGGCAGCGCGAGG + Intronic
1132964164 16:2642719-2642741 CTGGAGGCTCAGGCAGCGCGAGG - Intergenic
1133156452 16:3880137-3880159 CCGGCGGCGGCGGCGGCGGCCGG - Exonic
1133209829 16:4257445-4257467 CTGGAGGCAGAGGTGGGGGCTGG + Exonic
1133596465 16:7298360-7298382 CAGGAGGCGGAGGCTGCGGTAGG - Intronic
1134098571 16:11435863-11435885 CTGCAGGTGCAGGCAGCTGCCGG - Exonic
1134656128 16:15949678-15949700 TTGCTGGCGCGGGCGGCGGCGGG - Exonic
1134656146 16:15949728-15949750 CCGGTGGCGCGGGCGGCGGCGGG - Exonic
1135321721 16:21502007-21502029 GAGGAGGAGGAGGCGGCGGCGGG + Intergenic
1135517612 16:23148928-23148950 CGGGAGAGGCGGGCGGCGGCGGG + Exonic
1135572277 16:23558024-23558046 CTGGAGGCTGAAGCCGCGGCGGG + Exonic
1136073674 16:27804219-27804241 CTGGAGGGGCCGACGGTGGCAGG - Intronic
1136141655 16:28292593-28292615 CTGGAGCCGCAGCCGGAGCCCGG + Exonic
1136517357 16:30775947-30775969 GTGGAAGCGCGGGCCGCGGCAGG + Exonic
1136561592 16:31042334-31042356 CGGGAGGCGCAGTCGGGGGTCGG - Intronic
1137617691 16:49856916-49856938 CAGGCGGCGGCGGCGGCGGCCGG + Intronic
1138106826 16:54291482-54291504 CCGGAGGAGGAGGCGGCGGCCGG - Intergenic
1139390564 16:66604642-66604664 CTGGAGGAGCGGGTGGGGGCGGG + Intronic
1139403034 16:66696932-66696954 CTCTAGGCGCAGGTGGGGGCGGG - Intergenic
1139583091 16:67884770-67884792 TTGGAGGCGGAGCCGCCGGCTGG + Intergenic
1139904845 16:70357146-70357168 CAGGAGGCGGAGGCTGAGGCAGG + Intronic
1140223219 16:73058569-73058591 CTGGCGACGGCGGCGGCGGCGGG + Intronic
1141079182 16:81035880-81035902 TCGGAGGCGGCGGCGGCGGCGGG + Exonic
1141828985 16:86498989-86499011 AGGAAGGCGCCGGCGGCGGCGGG - Intergenic
1141841959 16:86579219-86579241 GCGGAGGCGCAGCCGGAGGCGGG + Exonic
1142156385 16:88534512-88534534 CAGTAGGGGCAGGCGGCGGCGGG - Exonic
1142262564 16:89049752-89049774 CGGGAGGCACAGTGGGCGGCCGG + Intergenic
1142421409 16:89972701-89972723 GTGGTGGCCCAGGAGGCGGCAGG + Intergenic
1142871619 17:2824822-2824844 GAGGAGGAGGAGGCGGCGGCTGG + Intronic
1142986024 17:3695796-3695818 CTGGAGAAGGACGCGGCGGCTGG + Intronic
1143059104 17:4185145-4185167 CAGGAGGGGCAGCTGGCGGCAGG - Intronic
1143747128 17:9003119-9003141 CCCGAGGCGCCGGCGGCAGCGGG - Intergenic
1143875100 17:9985456-9985478 ATGGGGGAGCAGGAGGCGGCAGG - Intronic
1145094010 17:20009325-20009347 CTGGAGGCGCCGGCGGAGCGCGG + Intronic
1145925651 17:28644947-28644969 CCGGCGGCGGCGGCGGCGGCGGG - Intronic
1147168556 17:38605575-38605597 CCGGGGGCGGGGGCGGCGGCCGG - Intronic
1147412225 17:40261918-40261940 TGGGAGGCGGAGGCGGAGGCGGG - Intronic
1147602572 17:41755323-41755345 CTGGAGGCGCAGGGTGCAGCAGG + Exonic
1148262091 17:46193020-46193042 GGGGAGGGGAAGGCGGCGGCGGG + Intronic
1148759818 17:49993834-49993856 GTCCTGGCGCAGGCGGCGGCTGG - Intronic
1149208501 17:54277026-54277048 CTGGGGGCGGAGGCGGTGGGGGG + Intergenic
1149313957 17:55421783-55421805 CTGGACACGCAGGCGGCCTCCGG - Exonic
1149891250 17:60392100-60392122 ATGGAGGCGGTGGCGGCGACCGG - Exonic
1151684743 17:75639910-75639932 CTGCCGGCCAAGGCGGCGGCTGG - Exonic
1151745081 17:76007608-76007630 CTGGAGGCCCAGGCGGCCACAGG - Exonic
1152621414 17:81366766-81366788 CTGGAGGCGCCCGGGGAGGCGGG + Intergenic
1152628131 17:81397590-81397612 CGGGAGGCGCCGGCCGGGGCTGG + Intronic
1152655558 17:81517754-81517776 CTGGAGGGGGGGGGGGCGGCCGG - Intronic
1152709819 17:81865800-81865822 CTGCAGGCGCAGGCTGCTGGAGG + Intergenic
1152711207 17:81871217-81871239 CCGGCGGCGCCGGCGGGGGCGGG - Intronic
1152875183 17:82782345-82782367 CTGGAGGGGGAGCCGGCAGCCGG + Intronic
1153794373 18:8609401-8609423 CAGGAAGCGCAGGCGCGGGCGGG - Intergenic
1153886953 18:9475641-9475663 GAGGAGGCGGAGGCTGCGGCGGG + Intronic
1154241476 18:12657627-12657649 GTGGCGGGGCTGGCGGCGGCGGG + Exonic
1154367703 18:13726481-13726503 CTGGCGGGGCCGGGGGCGGCAGG - Exonic
1155054380 18:22171337-22171359 CTCGACACGGAGGCGGCGGCCGG + Exonic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1155221443 18:23689605-23689627 CGGGAGGCGCAGGCGGAGAGCGG + Exonic
1155753806 18:29463958-29463980 GCGGAGGCGGAGGCGGAGGCGGG - Intergenic
1156099727 18:33578700-33578722 CGGGAGGCGCGGGCGGCGTGTGG - Intronic
1156411131 18:36829027-36829049 CCGGCCGCGCAGGCGGGGGCGGG + Intronic
1157248195 18:46071862-46071884 CTGGGGGCGCGGGCGGCAGAGGG + Intronic
1157384188 18:47247928-47247950 CTGAAGGCGGCGGCCGCGGCAGG + Intronic
1157718985 18:49908989-49909011 CTGGAGGGGCAGCCTGGGGCTGG - Intronic
1157753073 18:50195188-50195210 CCGGAGGCCCAGGTGGCAGCGGG - Intergenic
1157794311 18:50560272-50560294 CGAGAGGCGCAGGCGGCGGGAGG - Intronic
1158954140 18:62523553-62523575 CGGGCGGCGGCGGCGGCGGCGGG - Exonic
1159798105 18:72867784-72867806 GCGGCGGCGCCGGCGGCGGCGGG + Exonic
1159947851 18:74457284-74457306 CTCGGGGCGCGGGCGGCGGTGGG - Intronic
1160121117 18:76131177-76131199 CTGGAGAGGCAGGCAGGGGCCGG - Intergenic
1160204507 18:76822304-76822326 GTGGGGGCGGGGGCGGCGGCGGG - Intergenic
1160454691 18:78992426-78992448 CAGGGGCCGCAGGCGGGGGCCGG - Exonic
1160538721 18:79609231-79609253 CTGTTGGTGCAGGCGGCTGCAGG - Intergenic
1160708254 19:539825-539847 CTGGAGGTGGAGCCGGGGGCAGG + Intronic
1160754591 19:750924-750946 GTGGAGGGGCAGCCGGCAGCGGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160909089 19:1466590-1466612 CTGGAGGGGCTGGAGGAGGCCGG + Exonic
1160967894 19:1754521-1754543 CTGGGCGGGCTGGCGGCGGCCGG + Exonic
1161017992 19:1992922-1992944 CTGGAGGCGGAGGCGGGGCCGGG - Intronic
1161063781 19:2227897-2227919 GCGGAGGCGGAGGGGGCGGCCGG - Intronic
1161118224 19:2511382-2511404 CTAGAACCACAGGCGGCGGCTGG + Exonic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1161328061 19:3672884-3672906 CTGGAGGCGGTGGGGGCGGGGGG + Intronic
1161473325 19:4472252-4472274 CGGGAGGCGAAGCCGGGGGCGGG - Intergenic
1161477390 19:4494143-4494165 CTGGAGGCGGAGGGGGCGGTTGG - Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161852554 19:6745168-6745190 CCCGAGGCGAAGGCGGGGGCAGG + Intronic
1161925009 19:7293763-7293785 CTGGGGGCGCGGGCGTGGGCGGG - Intronic
1162535841 19:11262479-11262501 CGGGAGGCGGCGGCGGCGGCGGG - Intronic
1162582596 19:11539988-11540010 CTGGTGGCGTGGGGGGCGGCAGG + Intronic
1162721627 19:12666269-12666291 TTGGAGGGGCAGGAGGTGGCAGG - Intronic
1162758406 19:12874137-12874159 CTGTCGGCCCAGGCGGCGGACGG - Exonic
1163326139 19:16604525-16604547 CTGGATGTGCAGGCTGAGGCTGG + Intronic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1163849829 19:19656582-19656604 GTGGAGGCCCAGGGGGTGGCGGG - Intronic
1164477929 19:28589624-28589646 ATGGAGAGGCAGGCGGCGCCAGG - Intergenic
1164944950 19:32285649-32285671 CTGGGGGCGGAGGCGGGGGAAGG + Intergenic
1165129335 19:33622257-33622279 CTGGAGGCGCCCGCGGCCTCGGG + Intronic
1165169871 19:33884386-33884408 CTGGAGGAGCAGGCGGGGAAGGG - Intergenic
1165172869 19:33906154-33906176 CAGCTGGAGCAGGCGGCGGCCGG + Intergenic
1165213699 19:34254629-34254651 CGGCGGGCGCAGGCGGGGGCTGG + Intronic
1165287226 19:34852333-34852355 CAGGAGGCAGAGGCGGAGGCGGG - Intergenic
1165433977 19:35786953-35786975 ATGGGGGCGCAGGCTCCGGCCGG - Exonic
1165914154 19:39247727-39247749 CTGGAGCTGCTGGCGGCCGCGGG - Intergenic
1166067674 19:40369656-40369678 CTGGAGGGGCAGGAGGGGTCAGG + Intronic
1166091660 19:40513209-40513231 CTGGCGCGCCAGGCGGCGGCTGG - Exonic
1166316765 19:41993893-41993915 GTGGGGCCGCAGGGGGCGGCGGG - Intronic
1166356049 19:42228088-42228110 CTGGAGGCTGAGGCGGAGGCAGG + Exonic
1166678418 19:44753604-44753626 CCGGTGGCGCAGGCTGGGGCCGG - Intronic
1166737422 19:45094314-45094336 TTGGAGGAGGAGGCGGCGGTAGG - Intronic
1166748366 19:45152695-45152717 CTGGCGGTGCAGGCGCAGGCGGG - Exonic
1166843280 19:45711753-45711775 GTGGAGGCCCAGGCGGCAGCCGG + Exonic
1166852061 19:45765829-45765851 CTGGAGGTGGTGGCAGCGGCGGG + Exonic
1166871316 19:45872752-45872774 CTGGAGGCGGGGGCTGGGGCGGG - Exonic
1166882981 19:45940291-45940313 CGGGAGGCGGGGGCGGCGGCGGG + Exonic
1167007909 19:46787481-46787503 ATGGCGGCGGAGGCGGCGCCCGG + Exonic
1167104508 19:47422147-47422169 CGGGAGGGGAAGGGGGCGGCAGG - Intergenic
1167258098 19:48443007-48443029 CGGGGGGCGCGGGCGGCGACGGG - Exonic
1167297760 19:48661875-48661897 CTGCAGGCGCAGGCAGCCGCAGG + Exonic
1167455991 19:49596926-49596948 CTCGGGTCGCAGGCGGGGGCTGG - Exonic
1167465886 19:49651022-49651044 CTGGGGGTGCAGGGGGCGGTGGG - Exonic
1168064059 19:53909425-53909447 CCGGTGGCGGCGGCGGCGGCCGG + Exonic
1168076351 19:53982605-53982627 GCGGCGGCGGAGGCGGCGGCGGG + Exonic
1168154014 19:54463354-54463376 CGCGAGGCGCAGCCGGAGGCCGG - Exonic
1168238007 19:55075812-55075834 GCGGAGGCGGAGGCGGAGGCAGG + Intronic
1168332408 19:55578260-55578282 CTGGTGGCGCAGGAGGCTGTAGG + Exonic
1168401696 19:56089012-56089034 CTGGGGGCGCAGACTGGGGCGGG + Exonic
1168528514 19:57106898-57106920 GCGGAGGCGCAGGCGGAGCCCGG + Intergenic
1168705296 19:58467241-58467263 TTGGGGGCGCGGCCGGCGGCCGG - Exonic
926225844 2:10966347-10966369 CTGCAGGTGGAGGCGGCAGCTGG + Intergenic
926581349 2:14634566-14634588 CTTGAGGCCCAGGTGGCCGCAGG - Exonic
927139139 2:20118033-20118055 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927139152 2:20118075-20118097 CTGGAGGAGCAGGGGGAGCCCGG + Intergenic
927139163 2:20118117-20118139 CTGGAGGAGCAGGAGGAGCCCGG + Intergenic
927982121 2:27380698-27380720 ATGGAAGCGGCGGCGGCGGCGGG - Exonic
929777662 2:44938861-44938883 CGAAAGGCGCTGGCGGCGGCTGG + Intergenic
929778342 2:44942235-44942257 CGGGAGGCGGCAGCGGCGGCGGG + Exonic
929787177 2:45001343-45001365 CTGGAGCCGCTGCCGGCGGCCGG - Intergenic
930700874 2:54456852-54456874 AGGGAGGCGCCGGCGGAGGCAGG - Intronic
931334743 2:61328054-61328076 TGGGAGGCGGAGGCGGAGGCGGG + Intronic
931711015 2:64989201-64989223 CGGGTGCCGCAGGGGGCGGCCGG - Intronic
932257809 2:70302098-70302120 CTGGAAGGGCAGGCGGCGAAGGG - Intergenic
932725723 2:74178554-74178576 CTGGGGGCCGAGGCGGGGGCGGG - Intronic
932765308 2:74465368-74465390 GCGGAGGCGCAGGCGCTGGCTGG - Exonic
932827930 2:74958680-74958702 ATGGCGGCGGCGGCGGCGGCAGG + Exonic
932949715 2:76278886-76278908 CTGGATGGGCAGGCAGCGGAAGG - Intergenic
933666782 2:84971054-84971076 GAGGAGGAGGAGGCGGCGGCCGG + Intergenic
934636322 2:95992461-95992483 CTGGAGGCGCAGGCCTGGTCGGG + Intergenic
934797321 2:97112965-97112987 CTGGAGGCGCAGGCCTGGTCGGG - Intergenic
934836084 2:97590474-97590496 CTGGAGGCGCAGGCCTGGTCGGG + Intergenic
934978498 2:98822470-98822492 CGCGAGGGGCAGGCGGCCGCTGG + Exonic
935217821 2:100988710-100988732 CTGGAGGAGCAGGGGGCACCTGG - Intronic
935217828 2:100988729-100988751 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935217877 2:100988877-100988899 CTGGAGGGGCAGGGGGCGCCTGG - Intronic
935217906 2:100988951-100988973 CTGGAGGAGCAGGGGGCGCCTGG - Intronic
935237383 2:101150701-101150723 CTGGAGGCGCCGGAGGCTCCAGG - Intronic
935301536 2:101697655-101697677 CGGGAGGCGGAGGCGGAGGCGGG - Intronic
935592547 2:104855587-104855609 CGGCAGGGGCTGGCGGCGGCGGG + Exonic
935592557 2:104855611-104855633 GTGGCGGCGGCGGCGGCGGCGGG + Exonic
936954869 2:118013757-118013779 CTGCATGGGCAGGGGGCGGCGGG - Intronic
939432659 2:142130785-142130807 CCGGCGGCGGCGGCGGCGGCAGG + Exonic
939613024 2:144332556-144332578 CCGGAGGCCGAGGCGGCCGCGGG - Intronic
939629687 2:144516960-144516982 CGGGAGGCGGAGGCGGAGGGAGG + Intronic
941929972 2:170929438-170929460 CTGGAGGCGGGGCCGGCCGCGGG + Intronic
941930030 2:170929626-170929648 CTGGAGCTGGAGGCGGCTGCCGG + Intronic
942151107 2:173076308-173076330 CTGGAGGCGCGGGCGCAGGCCGG + Intronic
942450999 2:176107940-176107962 GTGGCGGCGCGGGTGGCGGCGGG - Exonic
942463907 2:176188761-176188783 CTGAGGGCGCAGGCCGGGGCCGG - Exonic
943269583 2:185781976-185781998 CTACAGGCGCAGGCCGCGCCCGG + Intronic
944798815 2:203215395-203215417 CTGGAGGTGGAGGCTGAGGCAGG + Intronic
944831177 2:203535170-203535192 GAGGAGGCGGAGGCAGCGGCTGG - Exonic
944921741 2:204421298-204421320 CTGGAGGTGGAGGTGGAGGCTGG - Intergenic
945304560 2:208246696-208246718 TGGGAGGCGGAGGCGGAGGCGGG + Intronic
945965697 2:216184586-216184608 CAGGAGGCTGAGGCGGAGGCAGG - Intronic
946322244 2:218960850-218960872 CTGGCGGCCGAGGAGGCGGCGGG - Exonic
946339777 2:219059815-219059837 CTGGAGGCGCAGGAGGCAGCCGG + Intronic
947418485 2:229921709-229921731 CTCCCGGCGCCGGCGGCGGCGGG - Intronic
947848671 2:233266209-233266231 GCGGAGGCGGAGGCGGAGGCGGG + Intronic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948801376 2:240435132-240435154 CTCGAGGCGCGGCCGGCGGGCGG + Intergenic
1169367243 20:5001460-5001482 CCGGAGGCGGAGGCTGCAGCGGG - Intronic
1169849549 20:10034877-10034899 GCGGAGGCGGAGGCGGGGGCGGG + Intronic
1170756873 20:19212696-19212718 GAGGAGGCGGAGGCGGCGGCCGG + Exonic
1170999107 20:21396165-21396187 ACGGCGGCGGAGGCGGCGGCGGG + Exonic
1171824065 20:29878625-29878647 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1172028954 20:31968266-31968288 GGGGAGGCGGCGGCGGCGGCCGG + Exonic
1172474531 20:35226889-35226911 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
1172978905 20:38926548-38926570 CTGGAGGAGCTGGTGGCGGGCGG + Exonic
1173251556 20:41366532-41366554 CGGGCGGCGCAGGCCGCGCCAGG + Exonic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1174373912 20:50112932-50112954 GAGGAGGAGCAGGCGGTGGCCGG - Intronic
1174380694 20:50153667-50153689 CTGCTGGCGGCGGCGGCGGCAGG + Exonic
1174569690 20:51492686-51492708 CTTGGGGAGCAGGAGGCGGCCGG + Intronic
1174804676 20:53594443-53594465 CCGGAGGCGGAGTCGGCGGCGGG - Intronic
1175161835 20:57013970-57013992 CGGGAGGGGCAGGTGGAGGCGGG - Intergenic
1175429535 20:58891706-58891728 ATGGCGGCGGCGGCGGCGGCGGG - Intronic
1175771627 20:61627926-61627948 CAGGGGGCCCAGGAGGCGGCTGG - Intronic
1176058562 20:63161618-63161640 CTGGAGGCGGAGGAGGTGGTGGG - Intergenic
1176156925 20:63626756-63626778 CGGGCGGCGCGGGCGGTGGCGGG - Intronic
1176665123 21:9679136-9679158 GTAGAGGCGCAGGCGGGAGCGGG - Intergenic
1176916938 21:14636741-14636763 CGGGAGGCTGAGGCGGTGGCGGG + Intronic
1177830824 21:26137044-26137066 CAGGAGGCGGAGGTGGAGGCGGG - Intronic
1178263442 21:31120793-31120815 TGGGAGGAGGAGGCGGCGGCTGG - Exonic
1178351154 21:31873702-31873724 CTGGGGGAGCCGGCGGCGCCTGG + Exonic
1178977960 21:37236241-37236263 CTGGACCCGCAGGCTGAGGCTGG + Intronic
1178992581 21:37367537-37367559 CTGGCTGCGGAGGCCGCGGCGGG + Intronic
1179605655 21:42513863-42513885 CAGGAAGCGCCCGCGGCGGCCGG + Intronic
1179885426 21:44312273-44312295 CTGGAGGAGCTGGTGGCGGAAGG + Exonic
1180074421 21:45455495-45455517 CTGGAGCTGCGGGCGGCGGGAGG - Exonic
1180095919 21:45555287-45555309 GGGGCGGCGCAGGGGGCGGCGGG + Intergenic
1180110260 21:45644026-45644048 CCGCAGGCGCCGGCGGCGGTCGG - Intronic
1180231064 21:46426961-46426983 CTGGAGGGGCGAGCGGAGGCGGG - Intronic
1180622796 22:17172811-17172833 CTGGAGAGGCAGGCTGAGGCGGG + Intergenic
1180877713 22:19182540-19182562 CTGGAGGCTCTGCAGGCGGCAGG + Intronic
1180961935 22:19766181-19766203 CTGCGGGCGGCGGCGGCGGCGGG - Intronic
1181299185 22:21867418-21867440 ATGGCGGCGGCGGCGGCGGCGGG - Exonic
1181522944 22:23459885-23459907 CTGGGGGCCCAGGGGGCGTCTGG - Intergenic
1181811005 22:25404109-25404131 CTGGAGGTGTAGGGGGCAGCGGG - Intronic
1182586361 22:31346207-31346229 GTGGCGGCGGCGGCGGCGGCTGG + Exonic
1182591418 22:31383417-31383439 TGGGAGGCGGAGGCGGAGGCGGG + Intergenic
1183373595 22:37449427-37449449 GTGGGGGCACAGGCGGGGGCCGG + Intergenic
1183670786 22:39271277-39271299 CTGGAGGCCCAGGTCTCGGCAGG + Intergenic
1183715023 22:39528491-39528513 CAGGAGGCGGAAGCGGAGGCAGG - Intergenic
1183720158 22:39557844-39557866 CGGGAGGAGGAGGAGGCGGCGGG - Intergenic
1184562105 22:45269256-45269278 GCGGAGGCGGAGGCGGGGGCGGG + Intergenic
1184715880 22:46281527-46281549 CTGCCGGGGCAGGCGACGGCAGG - Intronic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184767032 22:46577396-46577418 CGGGCGGCGGCGGCGGCGGCGGG - Intronic
1185053938 22:48568221-48568243 ATGGAGGCGCAGGCCAGGGCAGG - Intronic
1185066196 22:48632823-48632845 CTGCAGCCCCAGGCGGAGGCTGG + Intronic
1185161557 22:49232929-49232951 CTGGGGGCACAGGCTGGGGCAGG + Intergenic
1185218446 22:49616816-49616838 CTCCAGGCACAGGCGGCGTCGGG + Intronic
1185281769 22:49972665-49972687 CTGGAGGGGCAGGCAGGGCCGGG + Intergenic
1185335794 22:50270382-50270404 GCGGAGGCGGCGGCGGCGGCGGG + Exonic
1185341748 22:50294079-50294101 CCGGCGGCGCAGGAGGCGCCAGG + Intronic
950197003 3:11016353-11016375 TGGGAGGCGGAGGCGGAGGCGGG + Intronic
950530270 3:13549046-13549068 CCGGAGGCGGAGGCGGAGTCAGG + Intergenic
951080300 3:18444721-18444743 CCGGCGGCGGCGGCGGCGGCAGG - Intronic
951546570 3:23831944-23831966 TGGGAGGCGGAGGCGGAGGCAGG - Intronic
953999863 3:47547509-47547531 CTGGATGTGGAGGCGGAGGCAGG - Intergenic
954442686 3:50530439-50530461 TTTGGGGCGCGGGCGGCGGCGGG + Intergenic
954761398 3:52877287-52877309 CTGGAGCCGCAGCCAGTGGCAGG - Intronic
959049700 3:101513016-101513038 CGGGAGGCGCAGGCGGCAGCTGG - Intronic
961081571 3:124033063-124033085 CTGGGGGCGTAGGCGCCGCCGGG + Intergenic
961377439 3:126476067-126476089 CCGGAGGCGGAGGCGGGGGCGGG + Intergenic
961404147 3:126666991-126667013 GGGGAGGCGCAGCCAGCGGCAGG + Intergenic
961817496 3:129558813-129558835 CTGGAGGCTCAGGAGGGGGTTGG - Intronic
961827407 3:129606353-129606375 CTGGAGGCCGAGGCGGCCGTGGG - Exonic
962108514 3:132417700-132417722 CTGGAAGCTGAGCCGGCGGCGGG + Exonic
967858216 3:194134158-194134180 AGGGAGGCGGAGGAGGCGGCCGG + Intergenic
968225191 3:196968751-196968773 CAGGAGGCCCCGGAGGCGGCGGG + Exonic
968319388 3:197751397-197751419 TTGAAGGCGGAGGCGGAGGCAGG + Intronic
968434075 4:576106-576128 CAGGCGGCGGGGGCGGCGGCGGG - Intergenic
968483356 4:847010-847032 CGGGAGGCGGAGGCGGAGGCAGG - Intergenic
968593298 4:1470410-1470432 CTGGAGGAGGGGGCTGCGGCTGG + Intergenic
968616270 4:1579132-1579154 CTGGAGGCGCAGCCGCCTCCGGG - Intergenic
968812249 4:2805327-2805349 CTGGAGGCCCAGGCTGCGCTTGG + Intronic
968850580 4:3075029-3075051 GTGGCGGCGGGGGCGGCGGCGGG - Exonic
968874055 4:3255968-3255990 CAGCAGGCGGCGGCGGCGGCGGG + Exonic
968879552 4:3292260-3292282 CCAGAGGCGCAGGCCGGGGCCGG + Intergenic
969511839 4:7622542-7622564 CTGGAGTCCCAGGCAGGGGCTGG + Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
970333011 4:15003722-15003744 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
970967853 4:21948794-21948816 CTGCAGGTGCGGGCGGAGGCCGG + Exonic
972305528 4:37826640-37826662 GTGGAGGCGGAGGCGGGGGCGGG - Exonic
972738475 4:41867312-41867334 GCGGGCGCGCAGGCGGCGGCGGG + Intergenic
973279218 4:48341711-48341733 GCGGAGGCGGCGGCGGCGGCGGG + Exonic
973565678 4:52184826-52184848 CTGGGGGGGCAGGTGGAGGCAGG - Intergenic
974935809 4:68408717-68408739 CAGGAGGCTCAGGCTGAGGCAGG - Intergenic
975797713 4:78026773-78026795 TGGGAGGCGAAGGCGGAGGCAGG - Intergenic
977597663 4:98901443-98901465 GCGGAGGCGGAGGCGGAGGCGGG - Intronic
978384640 4:108167732-108167754 CCGGAGGAGGTGGCGGCGGCGGG - Exonic
978741818 4:112145647-112145669 CTGGCGGAGCGGGAGGCGGCAGG + Exonic
978777248 4:112516252-112516274 CAGGAGGAGGAGGCGGTGGCGGG - Intergenic
979530532 4:121765107-121765129 CTGGAGGCGCCGGCGCTCGCTGG + Exonic
980992329 4:139748524-139748546 CTGAAGGAGCAGGAGGCTGCTGG + Intronic
981504225 4:145482168-145482190 CTGGGGGCGCGGGCAGCGGCGGG + Intronic
981528788 4:145733153-145733175 GGGGAGGGGCAGGCGGCGGGTGG - Intronic
984767970 4:183413999-183414021 CGGGAGAGTCAGGCGGCGGCAGG - Intergenic
985126182 4:186696947-186696969 TTGGAGGTGCAGGCTGCAGCAGG + Intronic
985493374 5:191841-191863 CCGGAGCCGCCGGCGGCTGCGGG + Exonic
985576778 5:677321-677343 CTGGAGGGGCAGGTGGCTGCTGG - Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
985903237 5:2813562-2813584 CGGCAGGCGCAGGCGGTGGCAGG - Intergenic
986721480 5:10563983-10564005 ATGGGGGCGGAGGTGGCGGCGGG - Intergenic
987087450 5:14483751-14483773 CTGGAGGGGCAGGCGGGTGGTGG - Intronic
989103325 5:37839692-37839714 CTGTTGGCGGCGGCGGCGGCGGG - Intergenic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
989805252 5:45595999-45596021 CGGGAGGCTGAGGCGGGGGCGGG - Intronic
990743686 5:58937207-58937229 CTGGGGGCGGGGGCGGGGGCGGG + Intergenic
990955027 5:61332325-61332347 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
992105718 5:73448024-73448046 GCGGCGGCGCGGGCGGCGGCGGG - Exonic
992233426 5:74685116-74685138 CTGGAGGCGGAGTCGGGGGCGGG + Intronic
992663626 5:78985013-78985035 CTGGACGCGCTGGCGGCCGGCGG - Exonic
992716246 5:79514033-79514055 GCGGAGGCGGAGGCAGCGGCAGG - Exonic
994043628 5:95284678-95284700 GTGGCGGCGGCGGCGGCGGCGGG + Intergenic
995224655 5:109689640-109689662 GGGGAGGCGCAGGGGGCGGGCGG - Exonic
995354705 5:111224395-111224417 CTGCGTTCGCAGGCGGCGGCTGG + Exonic
998157531 5:139795405-139795427 CTGGAGGTGAAGGAGGGGGCGGG - Intergenic
1000052609 5:157575670-157575692 CAGGGGGCGCAGGCGCCGCCCGG - Exonic
1001035130 5:168291939-168291961 CGGGAGGAGCGGGCGGCGCCGGG + Intronic
1001159424 5:169300600-169300622 TTGGTGGGGCAGGCGACGGCTGG + Exonic
1001410091 5:171505317-171505339 CTGGAGGCACTGGTTGCGGCTGG + Intergenic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002350018 5:178577068-178577090 GCGGAGGCGCAGACGGCGACAGG - Intronic
1002374927 5:178781951-178781973 CTGGATACACAGGCAGCGGCCGG - Intergenic
1002455902 5:179345226-179345248 CGGGCGGCGGCGGCGGCGGCAGG + Exonic
1002466591 5:179411838-179411860 CTGGCGGAGCAGGAGGAGGCTGG - Intergenic
1002484362 5:179524267-179524289 CAGGAGGCACAGGCTGCAGCCGG - Intergenic
1002500213 5:179643221-179643243 CAGGAGGCACAGGCTGCAGCCGG + Intronic
1002501759 5:179651540-179651562 CAGGAGGCACAGGCTGCAGCCGG - Intergenic
1002621978 5:180494480-180494502 GCGGAGGCGAAGGCAGCGGCGGG + Exonic
1002632444 5:180590763-180590785 CTGGAGTCGGCGGCGGAGGCCGG - Exonic
1002666772 5:180831185-180831207 CCCGAGGCGGCGGCGGCGGCGGG - Intergenic
1002897859 6:1389750-1389772 CTGGCGGCGGCGGCGGCGGCGGG - Intergenic
1002927102 6:1611042-1611064 CCGGCGGCGCGGGCGGGGGCTGG - Exonic
1002927258 6:1611596-1611618 CGGGGGGCGCGGGCGGCGCCGGG + Exonic
1002991872 6:2245756-2245778 CCTGAGGCGGTGGCGGCGGCAGG - Intergenic
1003608054 6:7583407-7583429 CTGGAGGCCCAGGCAGCTACAGG + Exonic
1004216773 6:13711232-13711254 GGGGAGGCGGGGGCGGCGGCGGG + Exonic
1005040308 6:21595031-21595053 ATGGGGGCGGCGGCGGCGGCGGG + Exonic
1005731960 6:28706359-28706381 TGGGAGGCGGAGGCGGAGGCGGG - Intergenic
1006135443 6:31892973-31892995 CTGGAGCCCCAGGCGGGGGTGGG + Intronic
1006333976 6:33411003-33411025 CAGGAGGAGGAGGCGGCGGGGGG - Exonic
1006366832 6:33621151-33621173 CTGGCGGCGCATTCGGCGTCCGG + Exonic
1006375172 6:33667984-33668006 AGGGAGGAGCAGGCGCCGGCCGG - Intronic
1006846593 6:37066331-37066353 TGGGAGGCGGAGGCGGAGGCGGG + Intergenic
1008013327 6:46491203-46491225 GCGGAGGCGGAGGCGGCGGCTGG + Exonic
1008777704 6:55061601-55061623 GTGGAGGCACAGGCTGTGGCAGG + Intergenic
1010141499 6:72620175-72620197 CTGAAGGCGGAGGGGGCGGGAGG - Intergenic
1010210920 6:73362556-73362578 CTGGAGGCGGAGGCGAGGCCTGG + Intergenic
1011603572 6:89081321-89081343 CTCGGGGCCAAGGCGGCGGCCGG - Exonic
1012475775 6:99613748-99613770 CAGGCGGCGGCGGCGGCGGCGGG - Exonic
1013117716 6:107115211-107115233 GGGGAGGCGCTGGGGGCGGCGGG + Intronic
1013225763 6:108118532-108118554 CAGGGGGCGCAGGGGGCGGCCGG + Intronic
1014230075 6:118893890-118893912 CTGGAGGGGCGGGCGTCGGCCGG + Intronic
1015244512 6:131062509-131062531 CAGACGGCGCAGGCGGCAGCTGG + Intronic
1015776822 6:136822822-136822844 CGGGGGGCGGAGGCGGAGGCGGG + Intronic
1016992798 6:149941661-149941683 CTCGCGGCGCAGGCGGAGGGAGG + Intergenic
1017673993 6:156795162-156795184 CAGGAGGCGGAGGCTGCTGCAGG + Intronic
1017910573 6:158788901-158788923 CTGGAGGTGGAGGCAGCTGCGGG + Intronic
1018895831 6:168016438-168016460 CGGGAGGAGCAGCCGGTGGCTGG - Intronic
1019184376 6:170212603-170212625 CTGGAGGTGCGGGAGGAGGCAGG - Intergenic
1019198558 6:170296333-170296355 CTGGAGGTGGTGGCGGCGCCAGG + Intronic
1019215218 6:170438908-170438930 CTGGAGGAGCAGGCTGGGGGTGG + Intergenic
1019279672 7:193410-193432 CCGGCGGCGGAGGAGGCGGCCGG - Exonic
1019448401 7:1083226-1083248 CTGAAGGCGCGTGCGGCTGCTGG - Intronic
1019529919 7:1498336-1498358 CTGGAGGGGCACGTGGCGTCTGG - Intronic
1019893086 7:3962738-3962760 CTGGATGCGCAGGCCTCCGCTGG - Exonic
1020106801 7:5425975-5425997 CTGGAAGCCCAGGCGGGGGAAGG + Intergenic
1021615626 7:22500176-22500198 CTGGAGGCTCAGGCGCCGCGTGG - Exonic
1022090050 7:27102148-27102170 GTGGCGGCGGCGGCGGCGGCCGG + Exonic
1022101087 7:27169593-27169615 GCGGAGGCGGCGGCGGCGGCGGG - Intronic
1022156020 7:27662719-27662741 CTGGAGCCGGCGGCTGCGGCCGG - Exonic
1024561850 7:50651336-50651358 CTGGAGGTTCTGGCGGCTGCTGG + Intronic
1024957082 7:54933416-54933438 GTGGAGGAGGAGGCGGCGGCGGG + Intergenic
1025069716 7:55887709-55887731 CGGGAGGCGGAGGCGGGGGGCGG + Intronic
1026941303 7:74289486-74289508 CGGGGCGCGCAGGCGGCTGCTGG + Exonic
1027144327 7:75683526-75683548 CTGGAGGGGCAGGAGGAAGCTGG + Intronic
1028376875 7:90154459-90154481 CTGGAGGCTCAGGCGCCGCGTGG + Exonic
1029300697 7:99580357-99580379 CTGGAAACGCAGTTGGCGGCGGG + Intronic
1029896382 7:103989274-103989296 CTGAGGGCGCGCGCGGCGGCTGG - Exonic
1032119317 7:129144955-129144977 CCGGGGGCGGTGGCGGCGGCGGG + Exonic
1032458835 7:132094367-132094389 CTGGAGGCTCAAGGGGAGGCTGG - Intergenic
1032601526 7:133301200-133301222 GTGCAGGGGCAGGCAGCGGCAGG + Intronic
1033013345 7:137645498-137645520 CTGGGTGCACAGGCGTCGGCAGG - Exonic
1033165519 7:139035809-139035831 GCGGAGGCCGAGGCGGCGGCCGG - Exonic
1033339146 7:140478778-140478800 CGGGAGCCGGAGGCAGCGGCGGG + Intronic
1034224864 7:149474494-149474516 CAGGAGGTGCGGGCGGCGTCGGG + Exonic
1034447833 7:151122504-151122526 GAGGAGGCGGCGGCGGCGGCGGG - Intronic
1035458271 7:159023557-159023579 CTGTGGGCGCAGCCAGCGGCGGG - Intergenic
1038450029 8:27633921-27633943 CGGGAAGCGCGGGCGGCGGCGGG + Intronic
1038664846 8:29529225-29529247 GCGGAGGCGGAGGCGGAGGCGGG - Intergenic
1038883619 8:31640114-31640136 CTGGCGCCGGGGGCGGCGGCCGG + Intronic
1039426884 8:37493525-37493547 CTCCAGGAGAAGGCGGCGGCGGG + Intergenic
1039936634 8:42051770-42051792 GAGGCGGCGCAGGCCGCGGCGGG + Intronic
1041045358 8:53881927-53881949 GTGGAGGTGCAGGCTGCAGCTGG + Intronic
1041792670 8:61714440-61714462 CGGGAACCGCTGGCGGCGGCGGG + Exonic
1042040126 8:64581059-64581081 GTGGCGGCGGCGGCGGCGGCGGG + Exonic
1042482934 8:69324096-69324118 CTGGAGACCCAGGGGGCAGCTGG + Intergenic
1044302916 8:90606456-90606478 CGGGAGGCGCGGGCGGGAGCCGG - Intergenic
1045516293 8:102863626-102863648 CCGGCGGCGGCGGCGGCGGCGGG - Intronic
1046710609 8:117506921-117506943 CAGGAGGGGCAGGCGGCAGGAGG - Intergenic
1047418537 8:124686200-124686222 CTGGATGGGGAGGCGGCTGCAGG - Intronic
1048472703 8:134717770-134717792 CTGGAGGCGGAGGTTGCGGTGGG - Intergenic
1048554042 8:135457781-135457803 CTGGGGGCGCGGGCGGGGTCGGG + Exonic
1048581384 8:135732149-135732171 GTGGAGGTGGAGGCGGAGGCTGG - Intergenic
1049018379 8:139937508-139937530 CTTCAGGAGCAGGCGGAGGCTGG + Intronic
1049109800 8:140635655-140635677 CGGCGGGCGGAGGCGGCGGCGGG + Intergenic
1049170761 8:141159263-141159285 CAGGAGGGTCAGGCAGCGGCAGG + Intronic
1049175468 8:141189831-141189853 CTGCAGGTGCAGGCGGCTGTGGG - Intronic
1049415226 8:142491970-142491992 CAGGAGGAGCAGGCAGAGGCAGG + Intronic
1049419482 8:142510580-142510602 CCGGAGGAGCTGGGGGCGGCGGG + Intronic
1049668256 8:143858441-143858463 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049668672 8:143860040-143860062 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049669087 8:143861642-143861664 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049669502 8:143863244-143863266 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049669912 8:143864837-143864859 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049670329 8:143866445-143866467 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049670454 8:143867213-143867235 CTGGAGGTGCAGGTGGCCACGGG - Exonic
1049670504 8:143867441-143867463 CTGGAGGCGCAGGCCGCCACCGG - Exonic
1049670678 8:143868419-143868441 CTGGAGGCACAGGCAGCTACCGG - Exonic
1049671126 8:143870342-143870364 CTGGAGGCCCAGGCGGCCACCGG - Exonic
1049680946 8:143917900-143917922 CTGGAGGCGCAGGCGGCCACCGG - Exonic
1049681095 8:143918629-143918651 CTGGAGGCACAGGCAGCCACAGG - Exonic
1049681296 8:143919634-143919656 CTGGAGGCGCAGGCGGCCACTGG - Exonic
1049681702 8:143921611-143921633 CTGGAGGCGCAGGCGGCCTCAGG - Exonic
1052893180 9:33722113-33722135 CTGGAGGCACAGGGAGCTGCTGG + Intergenic
1053381284 9:37651179-37651201 CTGGTGGTGCAGGCGGAGGGCGG - Intronic
1054337225 9:63817734-63817756 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1054781937 9:69174010-69174032 CGGGAGGCGGCGGCGGCGGCAGG - Intronic
1055091118 9:72365283-72365305 CCGGCGGCGGCGGCGGCGGCGGG + Intergenic
1055562564 9:77535296-77535318 TGGGAGGCGGAGGCGGAGGCGGG + Intronic
1057131612 9:92657940-92657962 CTGTGGGAGCAGGCGGAGGCTGG - Intronic
1057463752 9:95292347-95292369 TCGGAGGCGGTGGCGGCGGCGGG + Intronic
1057573184 9:96219341-96219363 CAGGACGCGCGGCCGGCGGCTGG - Intergenic
1057596211 9:96417975-96417997 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
1057619171 9:96619634-96619656 CTGGGGGCGCCGGCCGCGGCAGG - Exonic
1057814693 9:98285875-98285897 CTGGAAGGGCAGGCCTCGGCTGG + Intergenic
1058233560 9:102461508-102461530 CTGGTGGGGCAGGGGGTGGCGGG + Intergenic
1059102419 9:111483573-111483595 CTGGGGGGGCAGGGCGCGGCCGG + Intronic
1060220054 9:121759763-121759785 CTGAAGGTGGAGGCGGCAGCGGG - Intronic
1061269383 9:129528895-129528917 TGGGAGGCGGAGGCGGAGGCAGG - Intergenic
1061293651 9:129666003-129666025 CTGGAAGAGGTGGCGGCGGCCGG + Exonic
1061404257 9:130384892-130384914 CAGGAGGCACAGGGGGAGGCTGG + Intronic
1061450405 9:130664368-130664390 GTGGAGGCGGAGGCGGGTGCGGG - Intergenic
1061472116 9:130835192-130835214 GTTAAGGCGCAGGCGGCGGCGGG + Intronic
1061541082 9:131278041-131278063 CAGGCGGCGGCGGCGGCGGCGGG + Intergenic
1061559574 9:131394026-131394048 GAGGAGGCGGGGGCGGCGGCAGG + Intergenic
1061582300 9:131545629-131545651 CTGGAGGGGCAGGTGCCGGAGGG + Intergenic
1061975881 9:134067884-134067906 CGGGCGGCGCGGGCGGCGGCGGG - Intronic
1062022626 9:134326586-134326608 CCGGCGGCGCAGGCAGCGGGCGG - Exonic
1062162440 9:135087748-135087770 CGCGAGGCGCAGGGCGCGGCGGG + Exonic
1062165347 9:135104808-135104830 CTGGAGGAGCAGGAGGCAGGAGG - Intronic
1062472260 9:136711842-136711864 CTGGAAGCGCCGGCGGCCGCGGG + Intergenic
1062489813 9:136799647-136799669 CTGGAGGAGCCAGCGGCTGCGGG + Intronic
1062534314 9:137014822-137014844 GTGGAGGGGGAGGCTGCGGCAGG + Intronic
1062574564 9:137200219-137200241 CGGGCGGCGGCGGCGGCGGCGGG + Exonic
1203377132 Un_KI270442v1:385055-385077 CTGGAGGAGCAGGTTGGGGCGGG - Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1190554429 X:51618791-51618813 ATGGCCGCGCAGGCGGCGGGAGG + Intergenic
1190560730 X:51682749-51682771 ATGGCCGCGCAGGCGGCGGGAGG + Intergenic
1190563561 X:51710572-51710594 ATGGCCGCGCAGGCGGCGGGAGG - Intergenic
1190700983 X:52989733-52989755 GTGGAGGCGGAGCCGGCAGCTGG + Intronic
1193155321 X:78166480-78166502 CTGGAGGCGGAGGTTGCGGTGGG - Intergenic
1193380295 X:80809503-80809525 CCGGAGGGGCTGGCGGGGGCGGG + Exonic
1193925486 X:87478883-87478905 CGGGAGGCGGAGGTTGCGGCGGG + Intergenic
1195347162 X:103962537-103962559 CTGGAGGCTCAAGCGGAGGAGGG + Intronic
1195360280 X:104076304-104076326 CTGGAGGCTCAAGCGGAGGAGGG - Intergenic
1196393451 X:115233910-115233932 GGGGAGGCGGCGGCGGCGGCGGG - Exonic
1198245465 X:134827205-134827227 CGGGAGGGGGAGGCGGAGGCGGG - Intronic
1198512479 X:137366474-137366496 CAGCAGGAGCAGGCGGCTGCTGG - Intergenic
1199736867 X:150693540-150693562 CCGGCGGCGGCGGCGGCGGCGGG + Exonic
1199990907 X:152987425-152987447 GGGGAGGGGCAGGGGGCGGCAGG - Intergenic
1199994430 X:153011687-153011709 TTGGAGGCAGAGGCGGAGGCGGG - Intergenic
1200033994 X:153316899-153316921 GGGGAGGGGCAGGGGGCGGCAGG - Intergenic
1200100930 X:153688850-153688872 CTGGGGGAGGAGGCCGCGGCGGG - Intronic
1200424919 Y:3009740-3009762 CTGGAGGGGGATGAGGCGGCAGG + Intergenic