ID: 1083048419

View in Genome Browser
Species Human (GRCh38)
Location 11:59755984-59756006
Sequence CAGGAAAGGGAGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2152
Summary {0: 1, 1: 1, 2: 14, 3: 190, 4: 1946}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083048419_1083048427 5 Left 1083048419 11:59755984-59756006 CCAGCCTCCTTCTCCCTTTCCTG 0: 1
1: 1
2: 14
3: 190
4: 1946
Right 1083048427 11:59756012-59756034 CTCCTGAGGTGCTACAGGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 179
1083048419_1083048426 0 Left 1083048419 11:59755984-59756006 CCAGCCTCCTTCTCCCTTTCCTG 0: 1
1: 1
2: 14
3: 190
4: 1946
Right 1083048426 11:59756007-59756029 TTTCTCTCCTGAGGTGCTACAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1083048419_1083048424 -9 Left 1083048419 11:59755984-59756006 CCAGCCTCCTTCTCCCTTTCCTG 0: 1
1: 1
2: 14
3: 190
4: 1946
Right 1083048424 11:59755998-59756020 CCTTTCCTGTTTCTCTCCTGAGG 0: 1
1: 0
2: 9
3: 56
4: 527
1083048419_1083048431 23 Left 1083048419 11:59755984-59756006 CCAGCCTCCTTCTCCCTTTCCTG 0: 1
1: 1
2: 14
3: 190
4: 1946
Right 1083048431 11:59756030-59756052 CCTGGCTGCCCCTTCCCCCAGGG 0: 1
1: 1
2: 7
3: 95
4: 618
1083048419_1083048429 22 Left 1083048419 11:59755984-59756006 CCAGCCTCCTTCTCCCTTTCCTG 0: 1
1: 1
2: 14
3: 190
4: 1946
Right 1083048429 11:59756029-59756051 GCCTGGCTGCCCCTTCCCCCAGG 0: 1
1: 2
2: 7
3: 106
4: 843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083048419 Original CRISPR CAGGAAAGGGAGAAGGAGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr