ID: 1083048516

View in Genome Browser
Species Human (GRCh38)
Location 11:59756619-59756641
Sequence CCATTTCCCCAGGTGATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083048513_1083048516 4 Left 1083048513 11:59756592-59756614 CCGCAGAATCAGAATCTAATTAT 0: 1
1: 0
2: 8
3: 23
4: 292
Right 1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG 0: 1
1: 0
2: 2
3: 21
4: 182
1083048512_1083048516 5 Left 1083048512 11:59756591-59756613 CCCGCAGAATCAGAATCTAATTA 0: 1
1: 1
2: 4
3: 74
4: 812
Right 1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG 0: 1
1: 0
2: 2
3: 21
4: 182
1083048510_1083048516 17 Left 1083048510 11:59756579-59756601 CCTGAGTCTAGCCCCGCAGAATC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG 0: 1
1: 0
2: 2
3: 21
4: 182
1083048511_1083048516 6 Left 1083048511 11:59756590-59756612 CCCCGCAGAATCAGAATCTAATT 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG 0: 1
1: 0
2: 2
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083048516 Original CRISPR CCATTTCCCCAGGTGATTCA TGG Intronic
900897728 1:5495544-5495566 ACTCTGCCCCAGGTGATTCAGGG + Intergenic
910991790 1:93064139-93064161 TTATTTCCCCATGTTATTCAAGG + Intergenic
911463555 1:98221867-98221889 CCAGATCACCAGGTGATTAATGG + Intergenic
913498439 1:119449233-119449255 CCATTCCCACAGGGGATTCATGG + Intergenic
913509467 1:119548888-119548910 CCATTCCCACAGGGGACTCATGG + Intergenic
913513272 1:119581718-119581740 CCATTCCCATAGGGGATTCATGG + Intergenic
913516902 1:119612702-119612724 CCATTCCCATAGGGGATTCATGG + Intergenic
915069296 1:153252875-153252897 CCATATCCCCATGTAACTCAGGG - Intergenic
915111901 1:153569171-153569193 CCCTTTCCCCAGGCCGTTCAGGG + Intergenic
915536839 1:156541452-156541474 CCAATTCCAAAGGTGATTCAAGG - Intronic
915918196 1:159953915-159953937 CCATATCCCCAGGTGTCTCTCGG + Intronic
916619742 1:166483831-166483853 ACATTTCCCCAGCTTTTTCATGG + Intergenic
919805887 1:201380784-201380806 CCACATCCCCAGCTGATTCTGGG + Intronic
922765751 1:228155793-228155815 CCGTTTCCTCAGCTGAATCAAGG + Intronic
923387878 1:233483708-233483730 CCATTATCCCAGGTGATCCCCGG - Intergenic
924023589 1:239810252-239810274 CGGATTCCCCAGGAGATTCAAGG + Intronic
1062842154 10:679867-679889 CCATTTATCCAGGCGATTCCAGG - Intronic
1065079210 10:22111168-22111190 CCATTTCCCCAATTATTTCATGG - Intergenic
1066065546 10:31759185-31759207 ACATTTCCCAAGATCATTCACGG - Intergenic
1068707358 10:60091636-60091658 CAATTTCCGCAGGTTATACAGGG - Intronic
1068832092 10:61507275-61507297 CAATTTCCCCAGGAGAGTTATGG + Intergenic
1068943753 10:62707145-62707167 CCAATTCCCCGTGTGATTCTTGG - Intergenic
1069538040 10:69270035-69270057 CCATTGCCCAAGATGTTTCAGGG - Exonic
1069562461 10:69440439-69440461 CTATTTCCCCAGGTCATTGAGGG - Intergenic
1069602377 10:69716406-69716428 CAAGATCTCCAGGTGATTCACGG - Intergenic
1070914463 10:80144236-80144258 CTCTGTCCCCAGGTGATCCACGG - Exonic
1071597747 10:86940477-86940499 CCATTTCCCCAGCATTTTCAGGG - Intronic
1072540740 10:96396366-96396388 GAAGTTCCCCAGGTGATTCAAGG + Intronic
1072629474 10:97135492-97135514 CCACTTCCCCTTGTGATTCCAGG - Intronic
1074977323 10:118592142-118592164 AAAGTTCCCCAGGTGATTCTAGG + Exonic
1075217797 10:120553806-120553828 CCATGTCCCCAGGTTACTCAGGG + Intronic
1079305042 11:19314529-19314551 CCACTTGGCCAGGTGAGTCAAGG - Intergenic
1081907268 11:46677974-46677996 CAATTTCCCCAGGGGATTAAGGG - Exonic
1083048516 11:59756619-59756641 CCATTTCCCCAGGTGATTCATGG + Intronic
1083934816 11:65864708-65864730 CCTCTTCCCCAGGTCATTGATGG + Exonic
1086069562 11:82785968-82785990 CCCCTTCCCCAGGTGTTACAAGG + Intergenic
1087155236 11:94895490-94895512 CCATTCCCCCAAGTCATACAGGG + Intergenic
1087577080 11:100002223-100002245 TCATTTCCCCAGTTGTTCCATGG + Intronic
1089299233 11:117488471-117488493 CCATCTCCCCAGGGAATTCGTGG - Intronic
1089613964 11:119684903-119684925 CCATTAGTCCAGGAGATTCACGG + Intronic
1090412048 11:126515975-126515997 CCATCTCCCCAGAAGATTCATGG + Intronic
1090869005 11:130726396-130726418 CCATTTGCCAAGTTGTTTCAGGG + Intergenic
1097469986 12:59977498-59977520 TCATTTCCTCAGGTGAGTCTAGG + Intergenic
1098357966 12:69628986-69629008 CCCTGTCCCCAGGAGATTCCTGG - Intergenic
1098524209 12:71468407-71468429 TCATTTCTCCAGGGTATTCATGG - Intronic
1098565691 12:71933083-71933105 CCATTTTTCCAGGTGTTTTAAGG + Intergenic
1100632830 12:96405722-96405744 CCATTTCCCCAGGAGCTTGTGGG + Intergenic
1101652234 12:106687904-106687926 CCATTTTCCCATGTGCTGCAGGG + Intronic
1104740108 12:131165859-131165881 CCATTTCTCCAGGGGACTCTGGG - Intergenic
1104947417 12:132422334-132422356 GCATTTCCCCAGGTGTTTCCAGG - Intergenic
1106451508 13:29886723-29886745 CAACATCCCCGGGTGATTCATGG + Intergenic
1106551184 13:30772497-30772519 CCATTAACCCAGGTGATTGGAGG - Intergenic
1106891863 13:34254567-34254589 CTAGTTTCCCAGGTGACTCATGG - Intergenic
1108228922 13:48318045-48318067 CCATTTCCCCAGGGAATGCCAGG - Intronic
1109214284 13:59570239-59570261 CCATCTCACGAGGTCATTCAGGG + Intergenic
1110782455 13:79481584-79481606 CCCTTTCCTCAGGTTATTCCCGG + Intronic
1110816842 13:79870740-79870762 CCATTTCAACACGTGATTGATGG - Intergenic
1111030778 13:82594914-82594936 ACATTTCCTCAAGGGATTCAAGG + Intergenic
1113822306 13:113223240-113223262 ACATTTCCCCAGGTGAGACTGGG - Intronic
1115439643 14:33418225-33418247 CCCTTTCCCTGGGAGATTCAGGG - Intronic
1116666353 14:47780883-47780905 CCATTTCCCCCGGATGTTCATGG + Intergenic
1120677972 14:87443853-87443875 TCATTTCCCCAGAGCATTCAAGG + Intergenic
1121181134 14:91929874-91929896 CATTTTCCCCAGGTGATTCATGG + Intronic
1121671907 14:95716635-95716657 CAAGACCCCCAGGTGATTCACGG + Intergenic
1121833240 14:97069768-97069790 CCATTGGCCCAAGTGACTCAAGG + Intergenic
1123193433 14:106593070-106593092 CTATTTCAAAAGGTGATTCATGG - Intergenic
1202946302 14_KI270726v1_random:29955-29977 TCAGTTCCCCAGGTGTTCCATGG + Intergenic
1124849693 15:33324310-33324332 CCATTTCCCCAGAAGATACAGGG - Intronic
1125470874 15:40002334-40002356 CCACATACCAAGGTGATTCATGG - Intronic
1126346952 15:47705707-47705729 CCAGTTCCCCAGGAAATTCCTGG + Intronic
1128311333 15:66633214-66633236 CCATTTCCCAAGGAGATGAAAGG - Intronic
1128425168 15:67535819-67535841 ACAGTTCCACAGGTCATTCATGG - Intergenic
1130427843 15:83819405-83819427 CAATTTTTCCAGGTGATTCAAGG - Intronic
1130850654 15:87790634-87790656 TCATTTCCCCAGGAGACTCACGG + Intergenic
1131132787 15:89910811-89910833 CCATTTCCCCTGGGGATGAAAGG + Exonic
1136870449 16:33802798-33802820 CTATTTTACAAGGTGATTCATGG + Intergenic
1141061517 16:80876713-80876735 CAATCTGCCCAGGTGTTTCAGGG + Intergenic
1203101723 16_KI270728v1_random:1313252-1313274 CTATTTTACAAGGTGATTCATGG - Intergenic
1143594525 17:7906434-7906456 CCAAATCCCCAGGTGCTCCAGGG - Intronic
1143965714 17:10755426-10755448 AAAGCTCCCCAGGTGATTCATGG + Intergenic
1144290808 17:13824470-13824492 CCAAATCCCCATGTGGTTCAGGG - Intergenic
1144392690 17:14810607-14810629 CCATTTCCCTAAGTGACTGAAGG - Intergenic
1145210312 17:21008206-21008228 CCATTTCCCCAGGCCTTTCCTGG - Intronic
1147141196 17:38461453-38461475 CCAGGCCCCCAGGTTATTCAAGG + Intronic
1149480765 17:57001389-57001411 CCATTTCCCCTGGGTCTTCAGGG - Intronic
1149919865 17:60647880-60647902 CCCTTCCCCCAGGTGATTTGTGG + Exonic
1150743378 17:67797384-67797406 GCATTTCACCAGGTGAGTGAAGG - Intergenic
1151363032 17:73600081-73600103 CCCTTTCCCCAGGAAAGTCAGGG - Intronic
1151772943 17:76177069-76177091 CCTGTTCCCCCGGTGCTTCACGG - Intronic
1152710788 17:81869730-81869752 CCGTTTCCGCAGGTGAGTCTGGG - Exonic
1153581396 18:6577564-6577586 CGAAGTCCCCAGGTGATGCAGGG + Intronic
1155182098 18:23356722-23356744 CCATTGCCCCAGGAAATGCAAGG + Intronic
1155567641 18:27153778-27153800 CCACTACACCAGGTGACTCAGGG + Intronic
1159108243 18:64027487-64027509 CCATTTCTCCAGCTGCTGCACGG - Intergenic
1160000620 18:75017541-75017563 CCATTCCTCAAGGTGATTAACGG + Intronic
1160049356 18:75417673-75417695 TCATTTCCCAAGGTGCTTCCAGG + Intronic
1160604384 18:80038331-80038353 CCATGTCCCCAGGTGAAGTAGGG - Intronic
1165292654 19:34900705-34900727 CCAAATGCCCAGGTGATTAATGG + Intergenic
1166259713 19:41628661-41628683 ACATTTCACCAGGGGATCCAGGG - Intronic
1166944236 19:46387354-46387376 CCATCTCCCCAGATCATGCACGG + Exonic
1167998959 19:53429616-53429638 CCCTGCCCCCAGGTGATTCTAGG + Intronic
925255372 2:2481262-2481284 TCATTTCCCCAGGTTGTTGAGGG - Intergenic
927819521 2:26250999-26251021 CCATTTTCCCAGTGAATTCATGG + Intronic
927930375 2:27039949-27039971 CCCTTTCCCCAGCTGTTTCTTGG + Intronic
928091192 2:28376085-28376107 ACATGTCCCCAGGTGATCCCCGG - Intergenic
934871315 2:97868897-97868919 CCATTTCCCTAATTGTTTCATGG - Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
938265279 2:129923646-129923668 CTGTGTCCCCAGGTGATCCACGG + Intergenic
940945848 2:159616283-159616305 CCTTTTCCCCAGATGGTTGAAGG + Exonic
941270889 2:163426963-163426985 CAATTTCCCCATGTGAATAAAGG + Intergenic
941539748 2:166767394-166767416 CCATTTCCTCAGGTTTTTCCTGG + Intergenic
943301883 2:186213065-186213087 CCATCTCATCAGGTGATGCAGGG + Intergenic
943712697 2:191115221-191115243 CCATTTGTCAAGGTGATTCCTGG + Intronic
944390907 2:199218459-199218481 CCATTTTCCCATGTGATAAAGGG + Intergenic
946104683 2:217358799-217358821 CCCTTGCCTCAGGTGATTCAGGG + Intronic
947723387 2:232382169-232382191 CAAGTCCCACAGGTGATTCAAGG - Exonic
1173136168 20:40441084-40441106 CTATCTCCCCAGGTGATTCTAGG - Intergenic
1173187592 20:40852844-40852866 CCATTTCTCCTGGTGACTCCTGG - Intergenic
1179383194 21:40918572-40918594 CCATTTCCTCAGGCAATGCAGGG - Intergenic
1182704274 22:32266080-32266102 CCATTTAGCCATGTCATTCAGGG + Intergenic
1184435405 22:44471345-44471367 CCACTTCCCCAGGAAATGCAAGG + Intergenic
1184521292 22:44995809-44995831 CCATCCCCCCACGTGATTCGGGG + Intronic
1184586441 22:45451239-45451261 CCATTTCCCAATGTGTTTCTGGG - Intergenic
1184796364 22:46735709-46735731 CCATTCCCCCAGGTGTATCTGGG - Intronic
954135300 3:48579587-48579609 CCCTTTCCCCAGGGGCTCCAGGG + Exonic
954457208 3:50606280-50606302 CCATTTCCCAAGGGGACCCAGGG + Intergenic
955937858 3:64119928-64119950 CCATTTTCCCAAGTGAATTAAGG + Intronic
956869153 3:73399409-73399431 CCACTCCCCCAGGGGATTCTAGG + Intronic
959484907 3:106916168-106916190 GCATGTCCCCAGGTAATACATGG - Intergenic
961506827 3:127375606-127375628 CAAGTTCCCCAGGTGATTCTCGG + Intergenic
961779490 3:129313421-129313443 CCAGATCCCCAGGTGGTTCTGGG - Intergenic
962710504 3:138081872-138081894 CCAGTTCCCAACGTGAGTCATGG - Intronic
964182858 3:153908655-153908677 TCATTTCCCCAGGTGACTGATGG + Intergenic
964323502 3:155522924-155522946 TCATTTAGCCAGGTGATCCAAGG - Intronic
964776975 3:160289723-160289745 CCATTGCTCCAGGTAATTGAAGG - Intronic
965890199 3:173503770-173503792 CCATTTCCAAAGGTGCTACAGGG + Intronic
965952201 3:174323544-174323566 GCATTTCCCCAGGTAAGACAAGG + Intergenic
971548424 4:27917055-27917077 CCATTTCCCCAAGTGAGGCTTGG + Intergenic
973839234 4:54844146-54844168 GCATTTCCCCCAGTGATTCTTGG - Intergenic
973949174 4:55993938-55993960 CCATATCCCCAGGTTATACAAGG - Intronic
978167881 4:105630768-105630790 CTTTATCCCCAGGTTATTCAGGG - Intronic
984206218 4:176791788-176791810 TTCTTTCCCCAGCTGATTCATGG - Intronic
984549982 4:181148172-181148194 CAATGCCCCCAGGTGATTCGGGG + Intergenic
984770944 4:183435952-183435974 TCATTTCCTCAGGGGATTCCGGG + Intergenic
988230391 5:28470707-28470729 CCATTACCCCATTTGTTTCATGG + Intergenic
992302937 5:75403728-75403750 ACAATTCCCCAAGTGATTGATGG - Intronic
992701156 5:79343116-79343138 GCACTTCCCCAGGTGCTGCAGGG - Intergenic
995058245 5:107786373-107786395 ACATTTGCCCATGTGATTTAAGG + Intergenic
995353419 5:111209449-111209471 CCACTTCTGCAGGTGGTTCAGGG + Intergenic
996728322 5:126692353-126692375 CCATTTTCCCAGGTAATGCTTGG + Intergenic
997145963 5:131433482-131433504 CCAATGCCCCAGTGGATTCAGGG + Exonic
997689946 5:135821620-135821642 ACATCTCCCCAGGAGACTCAGGG - Intergenic
998257731 5:140601378-140601400 CTATTGCCCCAGGTGATTCAAGG + Intergenic
998769965 5:145531651-145531673 CCATTTCCCCAGGCTCTGCAAGG + Intronic
999249004 5:150170654-150170676 CCACTTCCCCAGGTGAGTTGGGG - Intronic
999410270 5:151344234-151344256 GCCTTTCACCAGGTGAATCAAGG + Exonic
1001159919 5:169303649-169303671 CCACTTCCTCAGCTGATTCTGGG + Intergenic
1001453534 5:171844125-171844147 CCATTTCCTCACTGGATTCATGG + Intergenic
1003470241 6:6422599-6422621 CCATTTCCTCAGGCAATGCAGGG + Intergenic
1003990097 6:11477846-11477868 ACATTTCCCAAGGTGAGTGAGGG - Intergenic
1006791038 6:36701464-36701486 CCACTTCCTCTGCTGATTCATGG - Intronic
1009211450 6:60868151-60868173 CCATGGGTCCAGGTGATTCAGGG + Intergenic
1009953357 6:70421938-70421960 CCTTTTACCCAGATGATGCACGG - Intronic
1010760470 6:79716687-79716709 CAAGATCCCCAGGTGATTCAGGG + Intergenic
1012073460 6:94653637-94653659 CCCTTTCCTCAGATGATTTACGG - Intergenic
1014212767 6:118723497-118723519 CCATTTCCCCAGCTCTTCCAAGG + Intergenic
1014537263 6:122629064-122629086 TCATTTCCCCAGCTGATTATTGG - Intronic
1015722526 6:136258358-136258380 CCATTTTCCCAGGGGAGACAAGG + Exonic
1016183077 6:141170977-141170999 ACACTTCCTCTGGTGATTCAGGG - Intergenic
1017524044 6:155227218-155227240 CCATTTCCACAACTGTTTCATGG + Intronic
1020890583 7:13872801-13872823 CCTTTTCCCCATGGGAGTCAAGG + Intergenic
1021250423 7:18318474-18318496 CCATCTCCACAGGTGACTCCAGG - Intronic
1022264767 7:28743151-28743173 TCATTGTCCCTGGTGATTCAAGG + Intronic
1022688250 7:32617058-32617080 CTATTTGCCCACTTGATTCAAGG + Intergenic
1026289970 7:68997419-68997441 CCATTTCCCCCGGTAAGTGATGG - Intergenic
1026993080 7:74598739-74598761 CCATCTCTCATGGTGATTCAAGG + Intronic
1028238071 7:88384581-88384603 CCATTTCCACCCTTGATTCACGG - Intergenic
1028876287 7:95826987-95827009 CAAGTTCCCCAGGTGATCCATGG - Intronic
1031767581 7:125801216-125801238 CCATTTCCTCAGGCAATGCAGGG - Intergenic
1032293002 7:130606907-130606929 CCATTTCCCCTGTTCATTCATGG + Intronic
1032310373 7:130780554-130780576 CCCTTTCCCCAGGAGCTTCTGGG + Intergenic
1033659886 7:143395953-143395975 CCATTTCCTCTGGTGACCCAAGG + Intronic
1037368377 8:18146885-18146907 TCTCTTCCCCAGGTAATTCAAGG - Intergenic
1039777650 8:40752485-40752507 CCCTTTCTCCAGGTTATTCCAGG - Intronic
1042382148 8:68129259-68129281 CCAATTCCGGAGGTGATTCTGGG + Intronic
1042977455 8:74485766-74485788 CATTTTCCCCAGTTGATTCAAGG - Intronic
1043218936 8:77633900-77633922 CCAGTACCCCAGGTATTTCAAGG + Intergenic
1045295508 8:100868854-100868876 AAAGTTCCCCAGGTGATTCTAGG - Intergenic
1052159608 9:25240712-25240734 CCATTTCCACTGGTGCTACAGGG - Intergenic
1052475533 9:28954988-28955010 CAATTCCCTCAGTTGATTCAGGG - Intergenic
1055318277 9:75055882-75055904 CCATTTCATCAGGTTATCCATGG - Intergenic
1056106192 9:83349091-83349113 ACATGTGCCCAGGTTATTCAAGG + Intronic
1056459869 9:86799441-86799463 CCTTTTCCCCAGGGGAATGATGG + Intergenic
1056496441 9:87160076-87160098 CCAGTGTCCCTGGTGATTCAGGG - Intergenic
1056757018 9:89388211-89388233 CCATTTCCCCATGTGAGGGAAGG + Intronic
1057210827 9:93200179-93200201 CCATGTCCCCAGGGGTGTCAGGG - Intronic
1057736986 9:97671896-97671918 AAGTTTCCCCAGGTGATTCCAGG + Exonic
1057989754 9:99756351-99756373 CCATTTGCCCAGGTCATGAAAGG + Intergenic
1058241989 9:102575043-102575065 CCCTTTATACAGGTGATTCAAGG + Intergenic
1060544471 9:124452116-124452138 CCAACTCCCCAGGTGAATCAAGG + Exonic
1061308475 9:129746649-129746671 CCATTTCCGCCTGTGATGCAGGG + Intronic
1061835197 9:133324046-133324068 CCACTTCCCCAGCTGCATCATGG - Intergenic
1189597295 X:42582930-42582952 ACCTTTCACCAGGTGATTCTTGG - Intergenic
1191161217 X:57331308-57331330 CCTTTTCCCCAGGTGTTGCTGGG + Intronic
1196303541 X:114073329-114073351 CCAGTGCCCCAGGAGAATCAAGG + Intergenic
1196969374 X:121092144-121092166 CAATTCCCCCAGATGAATCAGGG - Intergenic