ID: 1083050051

View in Genome Browser
Species Human (GRCh38)
Location 11:59769041-59769063
Sequence GTTTCCCAATACATGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083050051_1083050056 26 Left 1083050051 11:59769041-59769063 CCTGCACACATGTATTGGGAAAC 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1083050056 11:59769090-59769112 TCATCCATTGATGGATACTTAGG 0: 30
1: 323
2: 1164
3: 3224
4: 6170
1083050051_1083050054 17 Left 1083050051 11:59769041-59769063 CCTGCACACATGTATTGGGAAAC 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1083050054 11:59769081-59769103 TTTATCCAATCATCCATTGATGG 0: 39
1: 413
2: 1734
3: 6680
4: 16843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083050051 Original CRISPR GTTTCCCAATACATGTGTGC AGG (reversed) Intronic
908876590 1:68684648-68684670 ATTTCCCTCTACATGTGTACAGG - Intergenic
910972914 1:92874498-92874520 GTTTCCAAATACATCTGACCAGG + Intronic
916328017 1:163585048-163585070 GTTTCCAAATACATGCTTACTGG + Intergenic
1063737095 10:8770278-8770300 GTTTCCCAATAAATGTCAGATGG + Intergenic
1065499756 10:26367944-26367966 CTTTCCCAATACCTGGCTGCTGG - Intergenic
1074018345 10:109558838-109558860 GTTCCCCAAAACATATGTGTTGG - Intergenic
1075286435 10:121190995-121191017 GTTTCCCAAGCCATGTGACCTGG + Intergenic
1075532566 10:123242079-123242101 GTTTCAAAATACAGTTGTGCTGG - Intergenic
1076041924 10:127257465-127257487 GGCTCCCAATTCATGTCTGCTGG + Intronic
1077949231 11:6937389-6937411 GTTTTCCAATACATGAACGCAGG - Intronic
1079722036 11:23827382-23827404 GTTTCCTAAGACATCAGTGCAGG + Intergenic
1083050051 11:59769041-59769063 GTTTCCCAATACATGTGTGCAGG - Intronic
1083949320 11:65945386-65945408 GTTTCCCCATCCATCTGTACAGG - Intergenic
1083957695 11:65994601-65994623 GTTTACAAAAACATCTGTGCTGG - Intergenic
1085966447 11:81533961-81533983 GTTTCCCCAGACATGAGTGTAGG + Intergenic
1097333879 12:58360647-58360669 GTTTCCCTGTACCTGTGTGAAGG + Intergenic
1098706715 12:73701100-73701122 GTTTCCAAATACAAGTGAACAGG + Intergenic
1106464439 13:30000035-30000057 ATTTCTGAAAACATGTGTGCCGG - Intergenic
1114074118 14:19144560-19144582 GATTTCCAATACTTGTGTGGAGG + Intergenic
1114088150 14:19255415-19255437 GATTTCCAATACTTGTGTGGAGG - Intergenic
1118794694 14:69130871-69130893 GTTTCGCCATTCATGTGTCCTGG + Intronic
1120354231 14:83408972-83408994 GTTTGCTAATACATGTCTCCTGG - Intergenic
1121904198 14:97724558-97724580 GTTTCCTCATGCCTGTGTGCTGG - Intergenic
1202871029 14_GL000225v1_random:164124-164146 GTTTTCAAATACATGTGTTTAGG - Intergenic
1124650778 15:31472273-31472295 GTTTCCCAGACCATGTGTTCCGG - Intergenic
1132244810 15:100286182-100286204 GTCTGCCAATACGTGTGTGCCGG - Intronic
1133325719 16:4941015-4941037 GTTTCAGAACACAGGTGTGCGGG + Intronic
1133905148 16:10015694-10015716 TGTTCCCAATAAATGTTTGCTGG - Intronic
1134176766 16:12013220-12013242 TTTTCCTAATATATGTTTGCTGG - Intronic
1138822928 16:60283409-60283431 CTATACCAATACATGTGTTCTGG + Intergenic
1139248011 16:65466566-65466588 GAATCCCAAAACATGTGAGCAGG + Intergenic
1143426281 17:6841626-6841648 GTTTGCAAATACCTATGTGCTGG + Intergenic
1145033518 17:19523691-19523713 GTTTCCCACTACAGGTAAGCTGG + Intronic
1145930705 17:28683246-28683268 GATTCCCCCTTCATGTGTGCAGG + Exonic
1146971847 17:37079599-37079621 GTTTACCAACATATGTGTACTGG - Intergenic
1149051349 17:52309338-52309360 ATTTTCCACTACGTGTGTGCTGG + Intergenic
1150887860 17:69108597-69108619 GTTACCCAATAAATGTGTACTGG - Intronic
1153512068 18:5866273-5866295 GTCTCCCAGTGCATATGTGCAGG - Intergenic
1155761868 18:29577705-29577727 GTTTCCAAATCCATGTTTGAAGG - Intergenic
928467645 2:31537720-31537742 GTTCCCCAAAATTTGTGTGCTGG + Intronic
931877670 2:66531464-66531486 GTTTTCTAATACATGTTTGAAGG - Intronic
935484459 2:103636156-103636178 GTTTCTGAATACAGATGTGCTGG - Intergenic
935492029 2:103733466-103733488 CTTTGCCAACACATGTGTGAAGG - Intergenic
935527841 2:104193414-104193436 TTTTTCCAATAAGTGTGTGCTGG - Intergenic
936484671 2:112915901-112915923 GGATGCCAATACCTGTGTGCAGG + Intronic
938387636 2:130878643-130878665 CTTTCCCAGCACATATGTGCAGG + Intronic
938605738 2:132890923-132890945 GTGTACCCATACATGTGTGAAGG + Intronic
938997598 2:136697013-136697035 GTTTCCCATTACTAGTGTGGTGG + Intergenic
941220435 2:162772602-162772624 GTTTCCAAATATATCTGAGCTGG - Intronic
947562333 2:231167293-231167315 GTGTCCTAATACATCTGTTCTGG - Intronic
948452369 2:238084082-238084104 GTTTCCCACTCCATCTTTGCAGG - Intronic
1170058630 20:12235217-12235239 GTTTGCCAATAAATGTCTACAGG - Intergenic
1174490410 20:50889311-50889333 ATTTCCAAATAAATGTGAGCTGG + Exonic
1180289766 22:10837500-10837522 GATTTCCAATACTTGTGTGGAGG + Intergenic
1180492563 22:15866922-15866944 GATTTCCAATACTTGTGTGGAGG + Intergenic
1181850887 22:25749241-25749263 CTCTCCCAAGAAATGTGTGCAGG + Intronic
1181933952 22:26426943-26426965 GTTTCCCAATGCAAGTGTTTTGG + Intergenic
950552176 3:13673251-13673273 GTTTGCCATTGCATGTCTGCGGG - Intergenic
955122745 3:56077300-56077322 GTTTACCAATACATTTGGGAAGG - Intronic
955554489 3:60121383-60121405 GTTTGAAAATACATGTGTACAGG + Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972853177 4:43074430-43074452 ATTTCCCATTAAATTTGTGCAGG - Intergenic
973105900 4:46336720-46336742 GTTCCTCAGTACATGTCTGCAGG - Intronic
973943249 4:55931895-55931917 GTTTCACAATACATTTCTGTTGG - Intergenic
974735404 4:65924664-65924686 GCTTCCTAATATATGTATGCTGG + Intergenic
979149621 4:117293706-117293728 GTTTAAAAATGCATGTGTGCTGG + Intergenic
981666536 4:147233335-147233357 GTATCCCAATGCTTGTGTTCAGG + Intergenic
985897564 5:2757945-2757967 CTTCCCCAACACCTGTGTGCTGG - Intergenic
987241467 5:16004364-16004386 CTTTCCCAATAAATATGTCCAGG + Intergenic
988428641 5:31093218-31093240 TTTTACCAATATATGTGTTCTGG + Intergenic
989794819 5:45454920-45454942 TCATCCCAATAAATGTGTGCTGG - Intronic
990786961 5:59432196-59432218 GAATCCCTATACATGTGTGAGGG - Intronic
997024177 5:130038542-130038564 TCTTCCCAATCCTTGTGTGCAGG - Intronic
997608463 5:135193276-135193298 GTCCCCCAATACCTGTGTGATGG - Intronic
998133798 5:139664255-139664277 GTTTCCCAGAACCTGTCTGCAGG - Intronic
1001715995 5:173816692-173816714 GACTCCCATCACATGTGTGCTGG + Intergenic
1001776793 5:174334867-174334889 GTTGCCTAATAAATGTTTGCTGG + Intergenic
1002352703 5:178594320-178594342 GTTTCCCCACACATGGATGCTGG - Intergenic
1005212345 6:23481376-23481398 GTTTCCAAATATATGTCTACAGG + Intergenic
1005605801 6:27476061-27476083 GTTTTCCAAATCATGAGTGCTGG - Intergenic
1014074810 6:117223816-117223838 GTTTCCCAAAATTTGTGTGTTGG + Intergenic
1014298128 6:119646056-119646078 GTTTTTCAAAACATTTGTGCTGG + Intergenic
1014987001 6:128023538-128023560 GTTTCCCAATAAAACTCTGCTGG + Intronic
1015510321 6:134031804-134031826 GCTTCCAAATACATATGTCCAGG - Intronic
1018987641 6:168649741-168649763 GCTGCCCAATACATGCTTGCTGG - Intronic
1023899588 7:44465346-44465368 GTTTCCCACTTCATGTGGACAGG - Intronic
1024135136 7:46399247-46399269 GTTTCCCAATATATGTGATTGGG + Intergenic
1026435478 7:70393305-70393327 GATTCCCAGCGCATGTGTGCTGG + Intronic
1026550856 7:71367364-71367386 GTTTACCTTGACATGTGTGCAGG + Intronic
1031965628 7:128026313-128026335 GTGTGCCCATACATATGTGCTGG + Intronic
1034676475 7:152896033-152896055 GCTTCCCAACAGGTGTGTGCCGG - Intergenic
1041080642 8:54211869-54211891 GATTCCCAAGACAAGTGTGCGGG - Intergenic
1047722649 8:127655805-127655827 CTTTCCTAATACATGTGTAGCGG - Intergenic
1057018568 9:91677840-91677862 GTTGCCCAGCACCTGTGTGCAGG - Intronic
1057725730 9:97566832-97566854 GACTCTCAATACATATGTGCTGG - Intronic
1058562317 9:106243079-106243101 TTTCCCCAGCACATGTGTGCTGG - Intergenic
1059968511 9:119640165-119640187 CTGTCCGAATAAATGTGTGCTGG + Intergenic
1185663860 X:1748842-1748864 GTTTCCCAAGCAATGTGTTCAGG + Intergenic
1187067819 X:15857489-15857511 GTTTCCTATTAAATGTGTGATGG + Intergenic
1187382733 X:18819897-18819919 GTTTCACAACAAATGTGTGTAGG - Intronic
1187439281 X:19303422-19303444 GTATTCCATTACATGTCTGCTGG - Intergenic
1188921648 X:35985413-35985435 CTTTGCCAGGACATGTGTGCAGG - Intronic
1190852730 X:54262549-54262571 GGTTTCCAATAAATGTGTGAAGG - Intronic
1195320872 X:103721118-103721140 GTTTCTCAAAGCATGTTTGCTGG + Intronic
1197426343 X:126301264-126301286 GTTTGCCAATACATATATTCTGG + Intergenic