ID: 1083053826

View in Genome Browser
Species Human (GRCh38)
Location 11:59800770-59800792
Sequence GAGTCAGCCACAAACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083053826 Original CRISPR GAGTCAGCCACAAACCTGGA AGG (reversed) Intronic
900162405 1:1230384-1230406 CAGTCTGCCACAAACCAAGAGGG + Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900465723 1:2824636-2824658 AAGACAGCACCAAACCTGGAGGG + Intergenic
900482233 1:2904940-2904962 AAGTCAGCCACAGCCCTGGCTGG + Intergenic
901013970 1:6217240-6217262 GAGCCAGCCAGAGACCAGGAAGG - Intronic
901724833 1:11232929-11232951 GAGTCAGGCACACACCATGATGG - Intronic
903648897 1:24911233-24911255 TAGTCAGCCACAAGCTTGAAGGG + Intronic
910342492 1:86203554-86203576 GAGAGAGGCACAAACTTGGAAGG - Intergenic
911284655 1:95975018-95975040 GTTTCAGGCACAAAACTGGATGG - Intergenic
911600446 1:99842576-99842598 GAGTCAAGCACACACCTCGATGG - Intergenic
913496667 1:119433860-119433882 GAGTCAGCCACAGACCTGACAGG + Intergenic
916753567 1:167745851-167745873 CAGTAAACCACAAACCTGAAAGG - Intronic
916852110 1:168714114-168714136 GGGTCACACACAAGCCTGGAAGG - Intronic
921338117 1:214108209-214108231 GAGTAAACCACAGACCTGGGAGG - Intergenic
921542065 1:216428749-216428771 TAGTCATTCACAGACCTGGATGG - Intergenic
923456877 1:234172321-234172343 GAGTCAGCCTTGAACCTGGGAGG - Intronic
923998641 1:239525995-239526017 GAGTCATTCCCAAACCTGGATGG - Intronic
924485948 1:244484608-244484630 GAGTAAGCCATAAACCGGGAAGG - Intronic
924814852 1:247432612-247432634 GAGGCAGACACAAACAGGGAAGG + Intronic
924823145 1:247513598-247513620 GTTTCAGGCACAAAACTGGATGG - Intronic
1065189403 10:23196382-23196404 GAGTAAGCCAAACTCCTGGATGG + Intergenic
1066240110 10:33525161-33525183 GAGTCAGGTCCAAACCTGGGTGG - Intergenic
1067024443 10:42831582-42831604 GAGTGACACACAAACCTAGATGG + Exonic
1067024619 10:42833442-42833464 GAGTGACACACAAACCTAGATGG + Exonic
1071087315 10:81877706-81877728 GAATCTGCCACAAACCAGAATGG + Intronic
1071286159 10:84147833-84147855 AAATTAGCCATAAACCTGGAAGG + Intronic
1071997223 10:91161137-91161159 GAGACAGCCGGAACCCTGGAGGG - Intergenic
1072225843 10:93368082-93368104 GACCCAGCCACAGAGCTGGAGGG + Intronic
1076138341 10:128060387-128060409 GAGTCTGCCCCAGAGCTGGAAGG - Intronic
1076721563 10:132395613-132395635 AAGTCAGCCCCACCCCTGGAGGG + Intergenic
1076895148 10:133307800-133307822 GAGTCACTCGCAGACCTGGATGG + Intronic
1077632251 11:3818625-3818647 CTGCCAGCCAGAAACCTGGATGG + Intronic
1081056524 11:38416182-38416204 GAGAATCCCACAAACCTGGATGG + Intergenic
1081456223 11:43225585-43225607 GAGGCAGCCACACACCCGAAAGG - Intergenic
1083053826 11:59800770-59800792 GAGTCAGCCACAAACCTGGAAGG - Intronic
1083763869 11:64833002-64833024 GGGACAGCCCCAAACCAGGACGG + Intronic
1085462634 11:76703513-76703535 GCTTCAGCCACAGACCTGAAGGG + Intergenic
1086914349 11:92511633-92511655 GGGTCAGCCCCCACCCTGGATGG + Intronic
1087070326 11:94073418-94073440 GATGCAGCCCCAAACCTAGATGG + Exonic
1091631831 12:2167638-2167660 GAGTCAGCCACAGATTTGGATGG + Intronic
1097809400 12:64002083-64002105 AAGGCAGCTAGAAACCTGGAAGG + Intronic
1097914524 12:65006439-65006461 CAGTCAGGTACAAGCCTGGAAGG - Intergenic
1099123311 12:78719910-78719932 CAGCCAGCCACAAGCCTGAAAGG + Intergenic
1099528126 12:83741023-83741045 GTTTCAACCACAAAACTGGACGG + Intergenic
1100694523 12:97077563-97077585 GAGTTGGCCAGCAACCTGGAAGG + Intergenic
1101499004 12:105283844-105283866 GAGTCAGCAACATACATGGCTGG + Intronic
1101541893 12:105672746-105672768 GACTCAGACACAAACATGCAGGG - Intergenic
1102933683 12:116880405-116880427 GGGCCAGCCAGAAACCTGGAGGG + Intronic
1105410540 13:20168001-20168023 GAGCCAGCCAGTCACCTGGAAGG + Intergenic
1105486020 13:20833611-20833633 GTGGAACCCACAAACCTGGAGGG + Intronic
1108094076 13:46881732-46881754 GAGTTGGGCATAAACCTGGAGGG + Intronic
1113598106 13:111548485-111548507 GGCTCAGCCACAACCCGGGAGGG - Intergenic
1113926511 13:113944570-113944592 GAGCCCGTCACACACCTGGAGGG - Intergenic
1113926619 13:113945084-113945106 GAGCCCGTCACACACCTGGAGGG - Intergenic
1113926626 13:113945124-113945146 GAGCCTGACACACACCTGGAGGG - Intergenic
1114322329 14:21557501-21557523 GGCTCAGCCCCAAGCCTGGAGGG + Intergenic
1118485638 14:66212305-66212327 GACCCAGCCAAGAACCTGGAAGG + Intergenic
1119748261 14:77059731-77059753 GAGTCAGCTCCAAACCAGGCCGG + Intergenic
1120599294 14:86481262-86481284 CAGTCACCAACAAACCAGGAAGG - Intergenic
1121955044 14:98205878-98205900 GAGTCAGCCCCAGGCTTGGAAGG + Intergenic
1123114613 14:105889044-105889066 GAGTCAGTGACCGACCTGGAGGG - Intergenic
1123121056 14:105917314-105917336 GAGTCAGTGACCGACCTGGAGGG - Intergenic
1123403769 15:20008889-20008911 GAGTCAGTGACTGACCTGGAGGG - Intergenic
1123513108 15:21015535-21015557 GAGTCAGTGACTGACCTGGAGGG - Intergenic
1124161203 15:27271601-27271623 CAGTCAGTCACAAACATGGCAGG + Intronic
1124661553 15:31554302-31554324 GAGGTAGCCCCAGACCTGGATGG + Intronic
1126951161 15:53883361-53883383 GTATCAGCCACAGCCCTGGAAGG + Intergenic
1128671663 15:69578426-69578448 GTGGAAGCCACAAAACTGGATGG + Intergenic
1129171159 15:73808939-73808961 GAGGCAGCCTCACACCTGGGAGG - Intergenic
1132351964 15:101145323-101145345 GAGGCAGCCAGAAAACAGGAGGG - Intergenic
1132703572 16:1231763-1231785 GAGTCAGCCCCAAACCAGGCTGG - Intergenic
1132704938 16:1239598-1239620 GAGTCAGCCCCAAACCAGGCTGG + Intergenic
1132707947 16:1254632-1254654 GAGTCAGCCTCAAACCAGGCTGG + Intergenic
1135549129 16:23385037-23385059 GCGAGAGCCAGAAACCTGGAAGG - Intergenic
1136859230 16:33686823-33686845 GAGTGACACACAAACCTAGATGG - Intergenic
1138039384 16:53646501-53646523 GAGTCAGAGACAAACCTTGAAGG + Intronic
1140770568 16:78200143-78200165 GAGTCAGCTGTAAAACTGGAAGG + Intronic
1142238501 16:88934473-88934495 GTCTCAGCCACACACCTGGCCGG + Intronic
1203120739 16_KI270728v1_random:1535009-1535031 GAGTGACACACAAACCTAGATGG - Intergenic
1145963921 17:28903445-28903467 GATGCAGGCACATACCTGGAGGG - Intergenic
1146100127 17:29972881-29972903 GAGTCAGCCTCAACCCTGTCAGG - Intronic
1146459391 17:33033567-33033589 GAGTCACCCACCAGCCTGCAGGG - Intronic
1148751913 17:49950182-49950204 GAAACAGCTACCAACCTGGATGG - Intergenic
1152539853 17:80969427-80969449 GAGTCAGGCACAGACCAGGAAGG + Intergenic
1155268304 18:24115219-24115241 CAGTCACCAACAAACCTGGAAGG + Intronic
1159479466 18:68969191-68969213 GATTCAGTCAGGAACCTGGATGG - Intronic
1161960056 19:7518179-7518201 CTCTCAGCCCCAAACCTGGACGG - Intronic
1164237090 19:23346670-23346692 GAGGTAGGCAAAAACCTGGAGGG - Intronic
1164586362 19:29478578-29478600 GAACCAGCCACAGGCCTGGAGGG - Intergenic
1164914740 19:32043404-32043426 GAGTTAACCCCACACCTGGATGG + Intergenic
1165400158 19:35594178-35594200 GCGTGAGCCACAGCCCTGGACGG + Intergenic
1167310475 19:48734893-48734915 GAGTCAGCCGCACGCCTGGCGGG + Intronic
925297551 2:2788039-2788061 GAGTCAGGCACACACCTTGGAGG - Intergenic
926381986 2:12300149-12300171 GAGGCAGGCACAAACCTGCCTGG - Intergenic
927487243 2:23496839-23496861 GAGTCTCTCACATACCTGGAAGG + Intronic
927697333 2:25247250-25247272 GAGTCAGTCTCAGCCCTGGAGGG + Intronic
932582384 2:73000265-73000287 GAGTCGGCCACCCACCTGAAGGG + Intronic
935868448 2:107417910-107417932 GAGTTGGCCAGAAACCTGGAAGG - Intergenic
942210124 2:173661672-173661694 GATTCAGTCACTTACCTGGAAGG + Intergenic
947577087 2:231284278-231284300 GAGTAAGTGACAAACCTAGATGG - Intronic
947838063 2:233189381-233189403 GATGCAGCCACAGTCCTGGAGGG + Intronic
947971688 2:234330399-234330421 GATTCTGCCACAAACCTGCAGGG - Intergenic
1169848054 20:10016724-10016746 GATACATACACAAACCTGGATGG + Intronic
1170266872 20:14476701-14476723 GATTCTGCCACTAACCTGGTGGG + Intronic
1170721031 20:18879359-18879381 GAGGCAGCCACAATCCTGCTAGG - Intergenic
1172595920 20:36151121-36151143 GAGTCAGCCACAGACCCCCAAGG - Intronic
1172694987 20:36816319-36816341 GAGACAGACACAACCCAGGAAGG + Intronic
1173201041 20:40955326-40955348 GCTTCAGCCACCAACCTGGTGGG + Intergenic
1175114406 20:56672135-56672157 GAGGCAGGCTTAAACCTGGAAGG - Intergenic
1179244116 21:39615227-39615249 AGGTCAGCCACAAAGCTTGATGG - Intronic
1180057819 21:45367966-45367988 GAGGGAGACACAAACCTGAACGG + Intergenic
1180758204 22:18177886-18177908 GAGTCCGGCACCAACCTGGGTGG + Intergenic
1180768492 22:18361678-18361700 GAGTCCGGCACCAACCTGGGCGG + Intergenic
1180777818 22:18500713-18500735 GAGTCCGGCACCAACCTGGGTGG - Intergenic
1180810544 22:18758024-18758046 GAGTCCGGCACCAACCTGGGCGG - Intergenic
1180826368 22:18864902-18864924 GAGTCCGGCACCAACCTGGCGGG + Intergenic
1181196687 22:21192279-21192301 GAGTCCGGCACCAACCTGGGCGG - Intergenic
1181212838 22:21300845-21300867 GAGTCCGGCACCAACCTGGGCGG + Intergenic
1181412365 22:22733262-22733284 CAGACAGCCCCAAACCTGAAGGG - Intergenic
1181419998 22:22791184-22791206 CAGACAGCCCCAAACCTGAAGGG - Intronic
1181424039 22:22821459-22821481 CAGACAGCCCCAAACCTGAAGGG - Intronic
1182131012 22:27850750-27850772 GAGTCAGCCAGGAACCAGGAGGG + Intergenic
1183118942 22:35714550-35714572 GAGTCAGCCCCAAGCCAGAAGGG - Intergenic
1183277957 22:36913214-36913236 GAAGCATCTACAAACCTGGAAGG - Intergenic
1183330237 22:37215904-37215926 GAGTCAACCACACACCACGATGG + Intergenic
1203230110 22_KI270731v1_random:102566-102588 GAGTCCGGCACCAACCTGGGCGG + Intergenic
1203276511 22_KI270734v1_random:90808-90830 GAGTCCGGCACCAACCTGGGGGG + Intergenic
950267116 3:11582371-11582393 GTCTCAGGCACAAAACTGGATGG + Intronic
950547697 3:13648386-13648408 AACTCATCCACAAAGCTGGAAGG - Intergenic
950672143 3:14533652-14533674 GTGTCAGAGACAAACTTGGAGGG - Intronic
953165112 3:40457740-40457762 GAGCCAGGCGCCAACCTGGATGG - Intronic
955320323 3:57969881-57969903 GAGTCAGCCTCTGACCTGGATGG - Intergenic
956514836 3:70035132-70035154 GATTCTGCCAATAACCTGGATGG - Intergenic
957685603 3:83501268-83501290 CAGACACCCACAAAACTGGAAGG - Intergenic
959228053 3:103611594-103611616 CAGTCAGCAACAAAACTGCATGG - Intergenic
959937368 3:112043217-112043239 TCCTAAGCCACAAACCTGGACGG + Intronic
967121580 3:186387073-186387095 GAGTCAACCCAAAACTTGGACGG + Intergenic
973792961 4:54395130-54395152 GAGTCAGCCCCCAACATTGATGG - Intergenic
975770169 4:77711837-77711859 GATACAGGCACAAACATGGATGG + Intergenic
975989118 4:80238573-80238595 GAGTCAGCCACTTGCTTGGATGG - Intergenic
977597929 4:98904057-98904079 GAGTTAGCCAAAAACCTGTGAGG - Intronic
978078919 4:104568240-104568262 GTTTCAGGCACAAAACTGGACGG - Intergenic
978460098 4:108942194-108942216 GTGACAACCACAAACCTTGACGG + Intronic
979108279 4:116715844-116715866 GACTCAGCCTCATGCCTGGATGG - Intergenic
980215023 4:129841322-129841344 AAGTCAGCCCCAAATCAGGAAGG - Intergenic
981205491 4:142035028-142035050 GACACAGACACAGACCTGGAGGG - Intronic
983081091 4:163386453-163386475 GAGGCAGCCAGAAAGATGGAGGG - Intergenic
985258551 4:188093142-188093164 GTCTAAGCCATAAACCTGGAAGG + Intronic
989463175 5:41724798-41724820 GACACAGAGACAAACCTGGAAGG + Intergenic
989821659 5:45800472-45800494 GAGGCAGTCACATTCCTGGATGG + Intergenic
992744929 5:79810199-79810221 CAGTGAGCAGCAAACCTGGAAGG + Intergenic
992917008 5:81466120-81466142 GAGACACCCACAAACCTATATGG + Intronic
993831839 5:92770060-92770082 CAGTCAGCTAGAAACCTTGAAGG + Intergenic
994560795 5:101368567-101368589 GAGTCAGTCACTAATCTAGATGG + Intergenic
997883650 5:137612215-137612237 GAGTCAGGCCCACACCTGGGGGG + Intergenic
1000020947 5:157319060-157319082 GAAGCAGCCAGAAACCTAGAAGG + Intronic
1002963228 6:1937160-1937182 GAGTGTTCCACAAGCCTGGATGG - Intronic
1005021512 6:21423498-21423520 GAGACACCCACAAGCCTGCAAGG + Intergenic
1005533052 6:26727894-26727916 GAGACAGCCTCAGACCTGGAAGG - Intergenic
1005535406 6:26750120-26750142 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1005537742 6:26773770-26773792 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1006985535 6:38173212-38173234 GAGTCAGCAACCATGCTGGAGGG + Exonic
1009006440 6:57793753-57793775 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1009008613 6:57816183-57816205 GAGACAGCCTCAGACCTGGAAGG + Intergenic
1009623006 6:66100066-66100088 GAGATAGCATCAAACCTGGAAGG + Intergenic
1011032567 6:82939678-82939700 GGGACAGACACAAACCTAGATGG - Intronic
1011079431 6:83473270-83473292 TCCTCAGCCACAACCCTGGATGG + Intergenic
1011919747 6:92557979-92558001 AAGGCAGCCAAAAACCTGCAGGG + Intergenic
1015907202 6:138129477-138129499 GAGTCATAAACAAACCTGAAAGG + Intergenic
1016562776 6:145415782-145415804 GTGTCAGCAACAAAGCTGGTGGG - Intergenic
1018763738 6:166912923-166912945 GAGACAGGCACAAGCCTTGAGGG - Intronic
1019321497 7:417470-417492 AACTCAGCCACAAACCTAGGAGG + Intergenic
1023883601 7:44335342-44335364 GCATCTGCCACACACCTGGAGGG + Intergenic
1032543720 7:132725035-132725057 AAGTCAGCCACAGACCTGGCTGG + Intronic
1035048916 7:155987130-155987152 GAGGCAGCAACAAACAGGGAGGG + Intergenic
1037951123 8:23019333-23019355 GAGGCAGCCACAGTCCTGGAGGG - Intronic
1038146445 8:24901091-24901113 GTGCAAGCCACATACCTGGAGGG + Intergenic
1040980073 8:53237931-53237953 GTGTCTTCCAGAAACCTGGAAGG - Intronic
1041971535 8:63748482-63748504 GAGTCAGTCACAGAGTTGGATGG - Intergenic
1044179664 8:89175029-89175051 GAGGCAACCATAAACCAGGAGGG + Intergenic
1044812714 8:96080419-96080441 GAGTCACCAACAAACCCTGAAGG - Intergenic
1044990110 8:97788371-97788393 GAGTCAGGCACACACCACGATGG + Intronic
1048192985 8:132307345-132307367 GAATCAGCCACAAACCTAAGGGG - Intronic
1048311125 8:133323272-133323294 GAGTCAGTCCCAAGTCTGGAGGG + Intergenic
1048480392 8:134785302-134785324 GGGCCAGCCACAGACGTGGAAGG - Intergenic
1056295722 9:85191126-85191148 GACTCTGCCATAAACCTGGCTGG + Intergenic
1058777772 9:108302198-108302220 AAGGCTGCCACAATCCTGGAGGG - Intergenic
1061176362 9:128999846-128999868 GAGTCAGGCACAGAGCTGGCGGG - Intronic
1061418349 9:130460256-130460278 GAGACAGCCACCCACCAGGATGG + Intronic
1062368364 9:136222952-136222974 GCGTCACCATCAAACCTGGAGGG + Intronic
1189206205 X:39241367-39241389 GAATCAGCCACAAAGCTGTTGGG + Intergenic
1192722227 X:73711168-73711190 AGGTCAGCCACAACACTGGATGG - Intergenic
1193370711 X:80694176-80694198 GTGTAAGCCCCAAACCTTGATGG + Intronic
1193716043 X:84935502-84935524 GAGTGAGCCACGACCCTGGCTGG + Intergenic
1194695517 X:97044926-97044948 AATTGAGCCACAAACATGGAAGG - Intronic
1194804975 X:98315931-98315953 TAGCCATCCACAAAACTGGAAGG + Intergenic
1195119091 X:101731904-101731926 CAGTGAGCCACCAACCTGGCTGG - Intergenic
1196013764 X:110915823-110915845 GAGTCAGGCAGCAAGCTGGAAGG - Intergenic
1197655917 X:129115767-129115789 GATTCAGCCACAAAGCATGAAGG + Intergenic
1200237037 X:154472734-154472756 GAGCCAGCCACTCCCCTGGATGG - Exonic