ID: 1083055825 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:59818742-59818764 |
| Sequence | CAGTTTATGCAGCAGGTGGT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1083055816_1083055825 | 25 | Left | 1083055816 | 11:59818694-59818716 | CCACAAGGTAATCTCCACATTTC | No data | ||
| Right | 1083055825 | 11:59818742-59818764 | CAGTTTATGCAGCAGGTGGTAGG | No data | ||||
| 1083055818_1083055825 | 11 | Left | 1083055818 | 11:59818708-59818730 | CCACATTTCACAGTGAGGTGCTG | No data | ||
| Right | 1083055825 | 11:59818742-59818764 | CAGTTTATGCAGCAGGTGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1083055825 | Original CRISPR | CAGTTTATGCAGCAGGTGGT AGG | Intergenic | ||
| No off target data available for this crispr | |||||