ID: 1083055825

View in Genome Browser
Species Human (GRCh38)
Location 11:59818742-59818764
Sequence CAGTTTATGCAGCAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083055816_1083055825 25 Left 1083055816 11:59818694-59818716 CCACAAGGTAATCTCCACATTTC No data
Right 1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG No data
1083055818_1083055825 11 Left 1083055818 11:59818708-59818730 CCACATTTCACAGTGAGGTGCTG No data
Right 1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083055825 Original CRISPR CAGTTTATGCAGCAGGTGGT AGG Intergenic
No off target data available for this crispr