ID: 1083056929

View in Genome Browser
Species Human (GRCh38)
Location 11:59830987-59831009
Sequence GTACAGCCAAGGCTATAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083056929_1083056934 29 Left 1083056929 11:59830987-59831009 CCAACCTATAGCCTTGGCTGTAC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1083056934 11:59831039-59831061 GCATGGTGACAGTTAACATCAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1083056929_1083056932 12 Left 1083056929 11:59830987-59831009 CCAACCTATAGCCTTGGCTGTAC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1083056932 11:59831022-59831044 TGCCTTTACATGTCTCTGCATGG 0: 1
1: 0
2: 3
3: 17
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083056929 Original CRISPR GTACAGCCAAGGCTATAGGT TGG (reversed) Intronic
902275558 1:15337082-15337104 GTCCAGCCAAGGCAGTAGGTGGG + Intronic
902821716 1:18947490-18947512 GTACAGCACAGGATAAAGGTTGG + Intronic
904861404 1:33540788-33540810 GTTTAGCCCAGGCTCTAGGTGGG - Intronic
908489327 1:64627277-64627299 GTGTAGCTAAGACTATAGGTGGG - Intronic
909007912 1:70298930-70298952 GTACATTCTACGCTATAGGTTGG - Intronic
913135763 1:115887592-115887614 GTACAGCAGACCCTATAGGTAGG - Intergenic
914049755 1:144121735-144121757 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
914129427 1:144843716-144843738 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
917956926 1:180108977-180108999 CTCCAGCCAAGGATATATGTTGG + Intronic
921825445 1:219667165-219667187 GAACAGCCAGGGCTACAGGAGGG + Intergenic
921930993 1:220754180-220754202 CTACAGCCTAGCATATAGGTTGG - Intronic
1065785796 10:29213457-29213479 GTACAGGCAAGGAAATAGTTGGG - Intergenic
1071255465 10:83868197-83868219 GTGAAGCCAAGGGTATATGTAGG + Intergenic
1073993991 10:109294976-109294998 CTACAGCCCAGGCTCTATGTTGG - Intergenic
1075271458 10:121055435-121055457 GTAAAGCCAAGGATATGGGAGGG + Intergenic
1083056929 11:59830987-59831009 GTACAGCCAAGGCTATAGGTTGG - Intronic
1086410413 11:86539198-86539220 GCATAGGCAAGGCTATAGGCTGG - Intronic
1088043434 11:105417831-105417853 GTACATCCAAGGTAATAGGAAGG + Intergenic
1088763175 11:112951088-112951110 GCAGAGCCAAGGCTAAATGTAGG - Intergenic
1088900356 11:114111332-114111354 GCACAGCCAATTATATAGGTTGG - Intronic
1095544312 12:43346553-43346575 GAACAGACAAGACTAGAGGTAGG + Intergenic
1096470150 12:51870440-51870462 GCAAAGCCAAGGCCAGAGGTGGG - Intergenic
1100613217 12:96209296-96209318 GTAGATCCAAGGCAAAAGGTAGG - Intronic
1104828719 12:131733536-131733558 GTGGAGCCAAGGCTGGAGGTGGG + Intronic
1108156904 13:47594585-47594607 GAACAGCCAGTGCTATAGTTTGG - Intergenic
1109116903 13:58399774-58399796 ATACAGATAAGGCAATAGGTGGG + Intergenic
1110593512 13:77292626-77292648 CTACAGCCAGGGTTATAGGGAGG + Intronic
1121564817 14:94901403-94901425 GTACAGCTAAGGCAGTGGGTGGG - Intergenic
1122083670 14:99284749-99284771 GAACAGCGAAGGCTACAGGATGG + Intergenic
1123419619 15:20120976-20120998 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
1123446245 15:20332560-20332582 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
1123528842 15:21127512-21127534 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
1128671100 15:69575370-69575392 GTACAGCCAGGGCTAGAGAGTGG - Intergenic
1133314364 16:4873242-4873264 GTAGAACCAAGGCTAGAGGGGGG - Intronic
1134621665 16:15694110-15694132 GCACAGACATGACTATAGGTTGG + Intronic
1141224590 16:82102873-82102895 CTGGAGCCAAGGATATAGGTTGG - Intergenic
1141727028 16:85796422-85796444 GTACACCCAAGACTAGAGGCAGG - Intronic
1203137462 16_KI270728v1_random:1737763-1737785 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
1146594675 17:34158024-34158046 GTACAGCCGGAACTATAGGTGGG + Intronic
1146914532 17:36670052-36670074 GGACAGCCCAGGCAAAAGGTTGG - Intergenic
1150883814 17:69062178-69062200 CTACAGAAAAGGTTATAGGTTGG + Intergenic
1159432759 18:68376819-68376841 TTACAGCCTAGGGTATAGTTAGG + Intergenic
1159615798 18:70578378-70578400 GTACAGCCACGGTTAAAGGATGG - Intergenic
1202689144 1_KI270712v1_random:74298-74320 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
928439821 2:31283140-31283162 GTAAAGCCAAGGCCACAGGCTGG + Intergenic
930325865 2:49916441-49916463 GTATAGCCATGGCTAAAGGAAGG - Intergenic
931769653 2:65486598-65486620 TTATAGCCAGGGCTATAGGAAGG - Intergenic
933957294 2:87381793-87381815 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
934241411 2:90273685-90273707 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
934271763 2:91543001-91543023 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
936147753 2:109992613-109992635 CTACAGCCAAGGCTAGAGGCAGG + Intergenic
936196938 2:110378834-110378856 CTACAGCCAAGGCTAGAGGCAGG - Intergenic
945965272 2:216180259-216180281 GTTCAGCAAAGGCAATAGGATGG + Intronic
1180552281 22:16550316-16550338 CTACAGCCAAGGCCAGAGGCAGG - Intergenic
1181351748 22:22263726-22263748 CTACAGCCAAGGCCAGAGGCAGG + Intergenic
1184974122 22:48048803-48048825 GTTCTGCCAAGGCTGCAGGTGGG + Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949669445 3:6381668-6381690 CTACAGCCAAGGCTATTGAGAGG - Intergenic
955480196 3:59382183-59382205 TTAGAGCCAAGGATATAGGCAGG - Intergenic
959483162 3:106897877-106897899 GTACAGCTAGTGCTATTGGTTGG + Intergenic
959640949 3:108634104-108634126 GTACAGCCAATCCGATAGGTGGG + Intronic
980998704 4:139807507-139807529 TTACATCCAAGGCTATGCGTGGG + Intronic
985359278 4:189155264-189155286 GTGCAGGCAAGGCTACAGGGAGG + Intergenic
987356958 5:17072053-17072075 GTATAGACAGGGATATAGGTAGG + Intronic
989092784 5:37751371-37751393 GGACAGCTTAGGCTCTAGGTAGG + Intronic
994318623 5:98363101-98363123 GTACAGACATGGCTATAGCATGG + Intergenic
995991303 5:118243076-118243098 GTATAGTCAAGGATGTAGGTTGG + Intergenic
999133175 5:149299845-149299867 GCACAGCCAGGGCTGTCGGTGGG - Intronic
999715561 5:154357249-154357271 GGAAAGCCAAGGCTACAGATGGG + Intronic
1000300330 5:159950845-159950867 GCACTGCCAAGGCTGTGGGTAGG - Intronic
1000546542 5:162610341-162610363 GTACAGCTCAGGCTGCAGGTGGG + Intergenic
1009303662 6:62060427-62060449 TGACAGCAAAGGCTATAGATGGG + Intronic
1012242150 6:96885471-96885493 GTTCAGCTAAGGCTATAGACTGG - Intergenic
1016152508 6:140760243-140760265 GTACAACCAAAGCTAGAGGCAGG + Intergenic
1017820160 6:158043382-158043404 GAACAGCCAGGGCTTCAGGTAGG + Exonic
1019677209 7:2321176-2321198 ATAAAGCCAGGGCTACAGGTGGG + Intronic
1023985586 7:45092749-45092771 ATACAGCCTAGGCTGGAGGTTGG + Intergenic
1030957504 7:115873065-115873087 GTTCATCCAAGGCTATGGGAAGG - Intergenic
1038033904 8:23670392-23670414 GTACAGCCAGAGTTCTAGGTTGG + Intergenic
1038424883 8:27458651-27458673 GTACAGCCAGGGGTAGGGGTGGG - Exonic
1039746353 8:40431462-40431484 GAAAAGCCAGGGCTATAGATCGG + Intergenic
1041310962 8:56516135-56516157 GTACAGCAAATACTATAGGTTGG + Intergenic
1046348755 8:112975781-112975803 TTACAGCCAAAGCTATATTTTGG - Intronic
1046861734 8:119100564-119100586 GTACAGCAGAGGATATAGTTGGG - Intronic
1047614697 8:126554733-126554755 GTACAGCCATGGCTATCGTCAGG - Exonic
1052651736 9:31311962-31311984 GATCAGTCAAGGCAATAGGTCGG - Intergenic
1053142223 9:35689403-35689425 GTACAGTCAAGGGTACTGGTGGG + Intronic
1055442564 9:76351102-76351124 GTAAAGCTAAGGCTACAGGTGGG - Intronic
1056092767 9:83220170-83220192 GTGCAGCCAAGGCTAACGCTTGG - Intergenic
1056395025 9:86174165-86174187 GCTCAGCCAAGGCTAGGGGTTGG + Intergenic
1056792549 9:89635503-89635525 GTACAACCCAGGCTATGGGTTGG - Intergenic
1060218378 9:121751888-121751910 GGACAGCCAAGGCCATGGCTAGG - Intronic
1190466729 X:50731918-50731940 ATACAGCCAAGACTATAGGCTGG + Intronic
1201762422 Y:17554951-17554973 GTACCGGCAAGGCCAGAGGTGGG + Intergenic
1201839130 Y:18351037-18351059 GTACCGGCAAGGCCAGAGGTGGG - Intergenic