ID: 1083059364

View in Genome Browser
Species Human (GRCh38)
Location 11:59853305-59853327
Sequence GCTCCTCCATTGTGAAACTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083059357_1083059364 11 Left 1083059357 11:59853271-59853293 CCCTGAATACAGGTGATATAGGG 0: 1
1: 0
2: 1
3: 12
4: 95
Right 1083059364 11:59853305-59853327 GCTCCTCCATTGTGAAACTGTGG 0: 1
1: 0
2: 0
3: 18
4: 122
1083059359_1083059364 10 Left 1083059359 11:59853272-59853294 CCTGAATACAGGTGATATAGGGC 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1083059364 11:59853305-59853327 GCTCCTCCATTGTGAAACTGTGG 0: 1
1: 0
2: 0
3: 18
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083059364 Original CRISPR GCTCCTCCATTGTGAAACTG TGG Exonic
902438708 1:16415361-16415383 CCTGCTCCATTGTGATATTGGGG + Intronic
904993330 1:34611760-34611782 GCTCTTCCATTTTGAAGCTGTGG + Intergenic
912456177 1:109799066-109799088 GCCCATCCATTATGAAAATGGGG + Intergenic
916412707 1:164561674-164561696 TCTCTTCTTTTGTGAAACTGTGG + Intronic
919268747 1:195310574-195310596 GCTTCTCCAGTGTGATACAGTGG - Intergenic
920713031 1:208313512-208313534 ATTCCCCCTTTGTGAAACTGAGG - Intergenic
922235258 1:223717777-223717799 GCTCCTCCAATGATAAACTGGGG - Exonic
923193103 1:231639665-231639687 TGTCCTCCCTTGTGAAAATGGGG + Intronic
924013433 1:239692800-239692822 GTTTCTCCATGGTGAAACTTGGG + Intronic
1063620307 10:7641267-7641289 CCTCCTCCATGGTGAAGTTGAGG - Intronic
1063937360 10:11092149-11092171 GCCCTTCCATTGTCATACTGGGG - Intronic
1064568453 10:16668142-16668164 GCTTCTCCTTTGAGAAAATGGGG + Intronic
1069797964 10:71065265-71065287 GCTCCTCCATTTAGCAGCTGGGG - Intergenic
1071750121 10:88465986-88466008 GCCACACCATTGTGTAACTGGGG + Intronic
1076888305 10:133272480-133272502 GGTTCTCCAGTGTGACACTGGGG + Exonic
1081553559 11:44136651-44136673 GCACCGCCACTGTGAAATTGAGG + Intronic
1083059364 11:59853305-59853327 GCTCCTCCATTGTGAAACTGTGG + Exonic
1085905625 11:80758324-80758346 TCTCCTCCTCTGTAAAACTGAGG - Intergenic
1088199148 11:107311384-107311406 GCTCCACCATCGTCAAAATGTGG + Intergenic
1088777731 11:113101782-113101804 TCTTCTCCATTGGGAAACTGAGG + Intronic
1091930272 12:4390299-4390321 GCTCCTCCAATGCCAAAGTGTGG - Intergenic
1092140242 12:6178803-6178825 GCTTCTCCATTGTGAGAGTGGGG - Intergenic
1092794757 12:12099204-12099226 GGCCCTCCATTGAGAACCTGAGG + Exonic
1096464078 12:51838596-51838618 TTTCCTCCATTGTGAAATGGGGG + Intergenic
1096489154 12:52004281-52004303 GCCCCTCCTTGGAGAAACTGGGG + Intergenic
1100772244 12:97936232-97936254 GCTCCTCGATTGGAAAACTAAGG - Intergenic
1100861943 12:98815687-98815709 GCTCCAGCATTGTGAACCTGAGG - Intronic
1103911024 12:124352350-124352372 GGCTCTCCATGGTGAAACTGAGG + Intronic
1104214538 12:126723285-126723307 GTGCCTCCATTGTTAAAATGAGG + Intergenic
1113087586 13:106584243-106584265 GGTCCACCTCTGTGAAACTGTGG - Intergenic
1113796128 13:113059714-113059736 GCTTCTCCATTGGGAAAGTGGGG - Intronic
1120086055 14:80274623-80274645 GGTTCTCCAATCTGAAACTGTGG + Intronic
1122124872 14:99573512-99573534 GCACCTCCATGGGGAGACTGAGG - Intronic
1122423698 14:101593049-101593071 GCTCCTCCTTAGTGAAGCTGAGG - Intergenic
1125369560 15:38957676-38957698 GCACCTCCATTGTCAAAATAAGG + Intergenic
1126356699 15:47803657-47803679 TCTCCTCAATTCTGAAACCGTGG - Intergenic
1127557183 15:60099198-60099220 GTTCCTCCCTTGTAAAACGGAGG - Intergenic
1128017663 15:64361781-64361803 GCTCGTCCTTTGTAAAACTATGG + Intronic
1128090078 15:64913227-64913249 TTTCTTCCATTGTAAAACTGGGG - Intronic
1131966846 15:97853298-97853320 GCTCCCACACTTTGAAACTGAGG + Intergenic
1132725174 16:1335277-1335299 GCTCCTGCCTTGTGGCACTGGGG - Intronic
1132990754 16:2791643-2791665 GCTCCTATGTTGAGAAACTGAGG + Intergenic
1135955765 16:26955150-26955172 GCTCTTCTTTTGTGAAAATGTGG - Intergenic
1136401398 16:30021285-30021307 GCACCTTCGTTGTGAAACTAAGG + Intronic
1138748238 16:59388676-59388698 CCTCCTCCATTTTGAAATTCAGG - Intergenic
1139233305 16:65308208-65308230 CCTCCTCCATTGTGGATTTGTGG + Intergenic
1139545278 16:67647030-67647052 GCCCCTCCATGGAGAAACTGAGG - Intronic
1140519424 16:75568554-75568576 GCTCCTCCACTGGGAGCCTGTGG + Intronic
1142923022 17:3207681-3207703 GCTCCCCTGTTGGGAAACTGGGG + Intergenic
1144052684 17:11510424-11510446 GTTCCTGCATTTTGCAACTGTGG - Intronic
1144585244 17:16483623-16483645 ACTCCTTCATTCTGGAACTGGGG + Intronic
1146163258 17:30571065-30571087 GCTCCACCAGGGAGAAACTGAGG + Intergenic
1148096369 17:45055063-45055085 CCTCCTCCATAATGAAACTTGGG + Intronic
1149607698 17:57936405-57936427 GTGCTTCCATTGCGAAACTGTGG - Intronic
1153376080 18:4380965-4380987 GCTCCTCGAATGTGAAAATAGGG - Intronic
1154306963 18:13237718-13237740 GGTTCTCCATGGGGAAACTGAGG - Intronic
1158545751 18:58395045-58395067 GCTCCTCCTCTGTGAAATAGGGG + Intronic
1159242446 18:65759691-65759713 GCTCCTTCATTTTGCAACTGTGG + Intronic
1162986403 19:14273032-14273054 GGGCCTCTGTTGTGAAACTGAGG - Intergenic
1163847888 19:19647466-19647488 GTACGCCCATTGTGAAACTGGGG - Exonic
1166916471 19:46198985-46199007 GCTCCTGGAATGTGAAACCGTGG - Intergenic
1168000490 19:53441949-53441971 GCACCTCCAGTGAGAAGCTGAGG + Intronic
925727600 2:6888862-6888884 CCTCCTCCACTGTGAGGCTGTGG + Intronic
926313164 2:11689223-11689245 GCTCCTCCATGTGTAAACTGAGG - Intronic
926796926 2:16626972-16626994 GCTTCTCCATTTATAAACTGGGG - Intronic
933235236 2:79857224-79857246 GCTCATTTATTGTGAGACTGGGG - Intronic
933292674 2:80454964-80454986 GCTCCTCAATTGTGAAAAGAAGG - Intronic
935607104 2:104982279-104982301 GCTCCTCCATGGGAAATCTGCGG + Intergenic
936255345 2:110906026-110906048 GTGCCTCCATTGGGAAACTGAGG + Intronic
941881768 2:170487799-170487821 GCTCCTGCATTTTTACACTGGGG - Intronic
946328383 2:218996593-218996615 CCTCCTCCAGTGTGAAACTCTGG + Intergenic
948401256 2:237687155-237687177 GCTCTTCCAATGTGCATCTGTGG + Intronic
948461994 2:238134281-238134303 GCTCCTCAGCTGGGAAACTGAGG - Intergenic
948624643 2:239261592-239261614 GCTCCTCCTCTGTGGACCTGAGG - Intronic
1169496098 20:6116931-6116953 GCTACTCCCTTGTGACACAGTGG - Intronic
1169585032 20:7072239-7072261 GCCCATAAATTGTGAAACTGAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1170363134 20:15569139-15569161 GATCAACCAATGTGAAACTGAGG - Intronic
1174611902 20:51804510-51804532 TCCTCTCCATTTTGAAACTGAGG + Intergenic
1175901341 20:62361036-62361058 TCTCCTCCTTTGAGAAACTAGGG - Intronic
1176070378 20:63223175-63223197 ACTCCTCCTCTGTGGAACTGTGG - Intergenic
1177004926 21:15660306-15660328 GCTCATAGTTTGTGAAACTGGGG - Intergenic
1177695060 21:24560373-24560395 GTTCAACCATTGTGAAAGTGTGG + Intergenic
1178995897 21:37399345-37399367 GCTACCCCATTATGAAATTGGGG + Intronic
1182721017 22:32400297-32400319 GCACCTCCATTTTGAAGCTGAGG + Intronic
1182785083 22:32900678-32900700 GGTATTCCATTGGGAAACTGGGG - Intronic
1184169948 22:42752819-42752841 GCTCATTCTTTGTGAGACTGTGG + Intergenic
1185003659 22:48262668-48262690 GCTCCTCCACGGTGGAGCTGTGG - Intergenic
1185292765 22:50035415-50035437 GCCCCACCACTGTGGAACTGTGG + Intronic
949395903 3:3614555-3614577 GCTCCAACATTTGGAAACTGTGG - Intergenic
950535900 3:13577958-13577980 CCTCCTCCACTGGGAGACTGGGG - Intronic
951681894 3:25303694-25303716 TTTCCTTCTTTGTGAAACTGGGG + Intronic
953675937 3:45002457-45002479 TCCCCTCCATTGTGAAACTCAGG - Intronic
955196841 3:56812331-56812353 GCTCCTACAGTGTTAGACTGTGG + Intronic
956677120 3:71746235-71746257 GCTCCTCATCTGTCAAACTGGGG + Intronic
957713229 3:83891169-83891191 GCCCCTCCACTTTGTAACTGTGG - Intergenic
961571791 3:127804494-127804516 GCTCTACCATGGGGAAACTGAGG - Intronic
961981019 3:131078612-131078634 GTTCTTCCATTGTAAAACAGAGG + Intronic
963311221 3:143712332-143712354 CCTCTTCCTTTATGAAACTGAGG + Intronic
964660751 3:159117631-159117653 GATCTTCCATTGATAAACTGTGG + Intronic
966124724 3:176562603-176562625 GCTCCCCCATTGGGTAACTTGGG + Intergenic
972778423 4:42264845-42264867 CCTCCTACATTGTGCAATTGTGG - Intergenic
972862963 4:43193725-43193747 GTTCCTCAACTGTGAAACTGTGG + Intergenic
975797637 4:78025866-78025888 CCTCCTCCATTTTGAAATTCAGG - Intergenic
979744418 4:124193310-124193332 ACTCCACAATTTTGAAACTGTGG - Intergenic
984056410 4:174935123-174935145 GCTCCTCAATTGTAAAACTAGGG - Intronic
984440478 4:179763159-179763181 GCTCCTACAATGTGAGTCTGTGG - Intergenic
987138600 5:14922412-14922434 GTTGCTCCCTTGTGAACCTGGGG + Intergenic
990563545 5:57006792-57006814 GGGCTTCCTTTGTGAAACTGTGG + Intergenic
991449718 5:66739171-66739193 TCTCATTCATTGTGAAAATGGGG + Intronic
992386251 5:76287453-76287475 GCTGCTAGAATGTGAAACTGGGG - Intronic
997200897 5:132009694-132009716 CCTCCTCTAATGGGAAACTGGGG - Intronic
997819665 5:137053593-137053615 GCTACTCCATAGTGCCACTGGGG + Intronic
999758213 5:154680929-154680951 GCTCCCCCTCTGTAAAACTGGGG + Intergenic
1001076199 5:168629858-168629880 GCACCTCCCTTTGGAAACTGAGG - Intergenic
1006930812 6:37687118-37687140 GCTCCTCCATCTGGAAAATGAGG + Intronic
1007273469 6:40656189-40656211 GCTCTTCCAATGTGTGACTGAGG + Intergenic
1009688654 6:66997555-66997577 GTTCAACCATTGTGAAAGTGTGG - Intergenic
1011602543 6:89073150-89073172 GCTTCTCATTTGTGCAACTGTGG - Intergenic
1012953961 6:105548532-105548554 GCGTCTCCATTGGGTAACTGTGG - Intergenic
1015784690 6:136910138-136910160 GCTACTCTATTGTGAACATGAGG + Intronic
1021159192 7:17250822-17250844 GCTACTCACTTGGGAAACTGAGG - Intergenic
1021265690 7:18518709-18518731 GTAACTGCATTGTGAAACTGTGG - Intronic
1026465683 7:70651939-70651961 GCGCCTCCATTTTGAAGGTGAGG + Intronic
1026517922 7:71088654-71088676 GTTTCTCCATATTGAAACTGGGG - Intergenic
1032673131 7:134104225-134104247 GATCATCCATTGTGAAAATGAGG - Intergenic
1035776627 8:2192327-2192349 GCTCCTTCATTATAAAACAGGGG + Intergenic
1039847872 8:41338559-41338581 GCTCCTCCATTGAGAGCCCGCGG - Intergenic
1044866739 8:96578570-96578592 TCTCTTCCATTGTAAAATTGTGG - Intronic
1045399994 8:101805257-101805279 GCTCCTCCCTTGAGAAGATGTGG + Intronic
1046018604 8:108636325-108636347 GCTCCCCAGTTGTGAATCTGAGG - Intronic
1050933412 9:11360922-11360944 GTTCCTCCATTCTGTAAATGTGG + Intergenic
1054747289 9:68867459-68867481 GCACCTCCATTGAGAAACACTGG - Intronic
1055594275 9:77849620-77849642 GCTCTTGCTTTGTGGAACTGTGG - Intronic
1055669165 9:78583246-78583268 GCTCCTCCTTTGAGCACCTGAGG + Intergenic
1057164562 9:92915458-92915480 TTTCCTCCTCTGTGAAACTGAGG + Intergenic
1057956712 9:99415299-99415321 GCTGCTCCATTCTGAAATTCTGG - Intergenic
1060717855 9:125950840-125950862 GCTCCTTCATGGTTAAAATGTGG - Intronic
1192163545 X:68808042-68808064 CCTCCTCCAGTGGGAAACTTTGG - Intergenic
1199536135 X:148905466-148905488 GCTCCTCCACTGTGAGCCTGTGG + Intronic
1201378777 Y:13349798-13349820 GCTCCTCCATAGTTAAGCTGGGG - Intronic