ID: 1083063557

View in Genome Browser
Species Human (GRCh38)
Location 11:59899595-59899617
Sequence GCCTCAGCCCGTCTGCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083063557_1083063560 9 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063560 11:59899627-59899649 TGTCAGCCCTAAGTGAAGACGGG No data
1083063557_1083063561 10 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063561 11:59899628-59899650 GTCAGCCCTAAGTGAAGACGGGG No data
1083063557_1083063559 8 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063559 11:59899626-59899648 GTGTCAGCCCTAAGTGAAGACGG No data
1083063557_1083063564 15 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063564 11:59899633-59899655 CCCTAAGTGAAGACGGGGCAGGG No data
1083063557_1083063566 16 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063566 11:59899634-59899656 CCTAAGTGAAGACGGGGCAGGGG No data
1083063557_1083063562 14 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063562 11:59899632-59899654 GCCCTAAGTGAAGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083063557 Original CRISPR GCCTCAGCCCGTCTGCACCC AGG (reversed) Intergenic