ID: 1083063562

View in Genome Browser
Species Human (GRCh38)
Location 11:59899632-59899654
Sequence GCCCTAAGTGAAGACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083063557_1083063562 14 Left 1083063557 11:59899595-59899617 CCTGGGTGCAGACGGGCTGAGGC No data
Right 1083063562 11:59899632-59899654 GCCCTAAGTGAAGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083063562 Original CRISPR GCCCTAAGTGAAGACGGGGC AGG Intergenic