ID: 1083066594

View in Genome Browser
Species Human (GRCh38)
Location 11:59930345-59930367
Sequence GACTTGGATGTGTTCTCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083066594_1083066598 19 Left 1083066594 11:59930345-59930367 CCTGCCGAGAACACATCCAAGTC No data
Right 1083066598 11:59930387-59930409 GCAGTCCTCCTAATACCTCCAGG No data
1083066594_1083066599 20 Left 1083066594 11:59930345-59930367 CCTGCCGAGAACACATCCAAGTC No data
Right 1083066599 11:59930388-59930410 CAGTCCTCCTAATACCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083066594 Original CRISPR GACTTGGATGTGTTCTCGGC AGG (reversed) Intergenic
No off target data available for this crispr