ID: 1083069889

View in Genome Browser
Species Human (GRCh38)
Location 11:59967060-59967082
Sequence TACCTACTCCATGTTCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083069889 Original CRISPR TACCTACTCCATGTTCCTAA AGG (reversed) Intergenic
904381252 1:30112484-30112506 TGCCCTCTGCATGTTCCTAAAGG + Intergenic
905361924 1:37426781-37426803 TATCTACTCCACCCTCCTAAGGG + Intergenic
909262333 1:73507353-73507375 TAACTACTCCATGTTTCTTTTGG - Intergenic
916272508 1:162958387-162958409 TAGCTACTCTCTTTTCCTAAGGG + Intergenic
916681952 1:167113016-167113038 TAGATTCTCCATGTTCCTAAAGG + Intronic
921146179 1:212359438-212359460 TCACTAGGCCATGTTCCTAAAGG - Intronic
924547037 1:245038791-245038813 TTCCTACTCCAAGTTTATAATGG - Intronic
1068061854 10:52078167-52078189 TAGCAAATCCATGTTTCTAAGGG - Intronic
1069848849 10:71391922-71391944 TACCTAACACATGTTCCTGAAGG - Intergenic
1070728340 10:78807740-78807762 CACCTCTTCCAGGTTCCTAATGG - Intergenic
1072047545 10:91671993-91672015 TACCTAATCCCTGTCCCAAAGGG + Intergenic
1072453179 10:95555295-95555317 TCCCTACTCCACGTCCCCAAAGG - Intronic
1073332887 10:102682294-102682316 TACCTACTCTCTGCTCCTGATGG + Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1073957794 10:108892630-108892652 AACCAACATCATGTTCCTAAAGG - Intergenic
1075837172 10:125464019-125464041 TACCCACTGCATGTCACTAAAGG - Intergenic
1077813079 11:5658327-5658349 TTCCTACTCCATCTTCCTTCTGG + Intergenic
1083069889 11:59967060-59967082 TACCTACTCCATGTTCCTAAAGG - Intergenic
1086047762 11:82553042-82553064 TTTTTACTCCATGTTGCTAAGGG - Intergenic
1090961849 11:131564155-131564177 TATCTACTCCATTTTACTAAGGG + Intronic
1092651928 12:10644169-10644191 CACCTTCTCCCTGTTCCTACTGG - Intronic
1094191245 12:27700467-27700489 TTCCTATTCCAGGTTCCTCAAGG - Intergenic
1098841910 12:75487533-75487555 TCCCTACTCCATGATCTAAAAGG - Intronic
1102510004 12:113408757-113408779 TCCTTATTCCATTTTCCTAACGG - Intronic
1105482922 13:20795634-20795656 TCACTTCTCCATGTTCCTCACGG - Intronic
1106497359 13:30292513-30292535 TCCCTACCCCTTGTTCCAAAGGG + Intronic
1111727327 13:92029240-92029262 TACCTAGTGCATGTTCATTATGG - Intronic
1116442031 14:44964227-44964249 TATCTGCTCCATGTGCCAAATGG - Exonic
1121882363 14:97512280-97512302 TAACTGCTCCATGTCCCAAAAGG - Intergenic
1123832366 15:24154005-24154027 GGCCTCCTCCATGTTCCTCAAGG + Intergenic
1125002397 15:34785169-34785191 TACCTAAACTATGTTCCCAAGGG - Intergenic
1126058585 15:44756423-44756445 TTCCTTCTGCATGTTCCTCAGGG - Exonic
1126708199 15:51427351-51427373 TACCTTCTCCATTTTCTTTAAGG + Intergenic
1128064872 15:64758377-64758399 TACCTGCTCCATGTGACTACAGG - Intronic
1129646058 15:77434280-77434302 TACCTACTCCAAGATCATAAAGG - Intronic
1130174477 15:81554092-81554114 TCCCTTCTGCATGTTGCTAATGG + Intergenic
1131824936 15:96312861-96312883 TACCTATTACAAGTCCCTAAGGG + Intergenic
1131879614 15:96849137-96849159 TACCTACTTCATCTTTCCAAAGG + Intergenic
1134288809 16:12886731-12886753 TTCCTACTTCAAGTTCCTGAGGG + Intergenic
1134769506 16:16794836-16794858 CACCTATTCCTTGTTCCTCATGG - Intergenic
1137548511 16:49420393-49420415 TAGCTTCTCCATGTTCAAAATGG + Intergenic
1147132179 17:38415895-38415917 TACCTTCTCCCTGTTCCCCAGGG + Intergenic
1149402834 17:56316363-56316385 TACCTCCTCCATTTTACAAATGG - Intronic
1149858859 17:60109721-60109743 TACCTACTTCATGCTTTTAAAGG - Intergenic
1150015110 17:61548788-61548810 TATATATTCCATTTTCCTAATGG + Intergenic
1151346863 17:73507674-73507696 CACCTGCTCCATCTGCCTAAGGG - Intronic
1151431918 17:74069543-74069565 TACTTTCTCCATGTTCTTCAAGG + Intergenic
1153690849 18:7592262-7592284 TACATAATCCATGTTTCTACAGG + Intronic
1156373374 18:36490896-36490918 TATCTACTCTGAGTTCCTAAAGG - Intronic
1159299626 18:66546168-66546190 TGCCTCCTCCATGCTTCTAAAGG - Intronic
1160409700 18:78667514-78667536 TCTCCACTCCATGTTTCTAAAGG - Intergenic
928759929 2:34570312-34570334 CACCTTCTCCCAGTTCCTAAAGG + Intergenic
929276276 2:40028268-40028290 AACCAATTCCATGTTCTTAAAGG + Intergenic
929566390 2:42988587-42988609 TGCCTACTCCATGGTCAAAAAGG + Intergenic
931251809 2:60538037-60538059 TACCTGCTCCAGGTTCCCACTGG + Intronic
935462561 2:103355367-103355389 TACCCCCTCAATCTTCCTAAAGG + Intergenic
935876728 2:107515379-107515401 TTCCCACTCCATGTCCCTAATGG - Intergenic
937571354 2:123366600-123366622 TACCTACACCCTGTTCAAAAAGG + Intergenic
942118548 2:172753250-172753272 TACCTACACTATTTCCCTAAAGG - Intronic
943863398 2:192895701-192895723 GAGATACTCCATGTTCATAAAGG + Intergenic
944722525 2:202438527-202438549 TACCTAATCCAGGATCATAAAGG + Intronic
945266447 2:207895740-207895762 TACCTTCTGCATGTTCTTACTGG + Intronic
1175435659 20:58945769-58945791 TACCTAGACCATGTTACTTATGG - Intergenic
949787571 3:7758769-7758791 TACATATGCCATGTTTCTAAAGG + Intergenic
953203146 3:40795745-40795767 CACCTACTTCAGGTTCCTAGAGG - Intergenic
954443329 3:50533642-50533664 TACTTATTCCATTTTCCAAAAGG - Intergenic
957683079 3:83464031-83464053 TACATTCTCCATGGTCCTAAAGG + Intergenic
962377541 3:134871003-134871025 TACCCACTCCAGGGGCCTAAGGG - Intronic
966027497 3:175302462-175302484 TAACTACTCCATATTTCAAATGG - Intronic
967743173 3:193025344-193025366 TAGCTACTTCATTTTCCTTAAGG + Intergenic
970872352 4:20830450-20830472 TACCTTCTGCATGTTCTTATGGG + Intronic
971241411 4:24892305-24892327 TACCTACTTCATGGTACTATAGG + Intronic
971547527 4:27905437-27905459 TTCCTAGTCCAGATTCCTAATGG + Intergenic
974657606 4:64845222-64845244 TACCTACTTCTTGTCTCTAAAGG - Intergenic
975210687 4:71696482-71696504 TCCCTACCCCATGTTCATAGAGG + Intergenic
976730932 4:88260413-88260435 GAAATTCTCCATGTTCCTAAAGG + Exonic
978884447 4:113750309-113750331 TTCCTGCTCCATCTTCCTGATGG - Intronic
981797073 4:148607619-148607641 TACCGAGTCATTGTTCCTAAGGG + Intergenic
984031343 4:174607582-174607604 CACCTTCTCCATTTTCCTTAAGG - Intergenic
984111408 4:175620498-175620520 TGCCTCCTCCCTTTTCCTAACGG - Intergenic
986123740 5:4866880-4866902 TATCTATTCCAGCTTCCTAAGGG + Intergenic
986805121 5:11301950-11301972 TACCCACTCCCTCTTCCTCAAGG - Intronic
987590124 5:19914008-19914030 TATCTGCTCTATGATCCTAATGG - Intronic
989671882 5:43927398-43927420 AACCTCCTCAATGTTCCTCAGGG - Intergenic
992289045 5:75265833-75265855 TACCCACTAGATGTTGCTAAAGG - Intergenic
993692702 5:91022506-91022528 TACCTACTCCCTGTGCTTTAAGG + Intronic
999446473 5:151644407-151644429 TATTTACTCTCTGTTCCTAAAGG + Intergenic
1000105036 5:158051629-158051651 TCCTTATTCCATGTTCCTCAAGG + Intergenic
1003736034 6:8878618-8878640 TACCTACTCCTTTTCCCCAAAGG + Intergenic
1008650607 6:53557420-53557442 TGCCTTCTCCATTTTCCTTAAGG - Intronic
1009044265 6:58218706-58218728 TGCCTATTCCTTCTTCCTAAAGG - Intergenic
1010090458 6:71974116-71974138 TGCCTCCTCCCTGTTCCTTAAGG - Intronic
1011972638 6:93246789-93246811 TACCTACTACAAGTTCCCAGGGG + Exonic
1015417847 6:132970055-132970077 TGCCTCCTCCCTGTTCCAAACGG + Intergenic
1016457993 6:144251035-144251057 TACTTCCTCCATGTTGCTTAAGG - Intergenic
1017010677 6:150061487-150061509 TACATACTGCATGTTCCCATTGG - Intergenic
1020473314 7:8564592-8564614 CACTTACTCCAAATTCCTAATGG + Intronic
1021165415 7:17333672-17333694 GAACCACTCCTTGTTCCTAATGG - Intronic
1023493989 7:40774859-40774881 TACCAACTAAATGTTACTAATGG - Intronic
1024734642 7:52291526-52291548 TTTCTTCTCCATGTTCATAAGGG - Intergenic
1027684856 7:81267284-81267306 TGCCTTCTCCATGTTCATAGGGG + Intergenic
1028586554 7:92457577-92457599 TAGATACTACCTGTTCCTAATGG - Exonic
1030264190 7:107601052-107601074 TCCCAACTCCATTTTCCTGAAGG + Intronic
1035452964 7:158990462-158990484 GACCTACTTCATTTTCCTAACGG - Intergenic
1037286008 8:17301201-17301223 CCACTACTCCATGTTCCTTAAGG - Intronic
1042553743 8:70016841-70016863 AACTTTCTCCATGTGCCTAATGG - Intergenic
1046219158 8:111190816-111190838 TACTTAGTCTATCTTCCTAAAGG + Intergenic
1048801197 8:138195440-138195462 TACCTATTCTAACTTCCTAAAGG + Intronic
1053202585 9:36163016-36163038 TGCCTGCTCCATGTTCCTGATGG - Exonic
1053560515 9:39189055-39189077 TACCAATTCCATGTTCTTGATGG - Intronic
1053824615 9:42009296-42009318 TACCAATTCCATGTTCTTGATGG - Intronic
1054136604 9:61429900-61429922 TACCAATTCCATGTTCTTGATGG + Intergenic
1054605956 9:67178067-67178089 TACCAATTCCATGTTCTTGATGG + Intergenic
1058480949 9:105394910-105394932 TACCTACTCTATCTTCTTTAGGG + Exonic
1186209522 X:7234695-7234717 TACATCCTCCAAGTGCCTAAAGG - Intronic
1186430223 X:9498743-9498765 TCCCTCCTCCATGTCCCCAATGG - Intronic
1187015510 X:15323838-15323860 TACCTTCTCCATGTTCCACCTGG + Intronic
1187462345 X:19498976-19498998 TAGCTTCTCCATGTACATAATGG - Intronic
1188917360 X:35928732-35928754 TACCTAATCCTTGATCATAATGG + Intronic
1193896703 X:87123030-87123052 TTCCTACTTCTTTTTCCTAAAGG + Intergenic
1194845050 X:98795557-98795579 TACCTACTAAATATTCATAATGG + Intergenic
1196462082 X:115942206-115942228 TATACACTCCATCTTCCTAATGG - Intergenic
1198492137 X:137152393-137152415 TATCTACTCCATCTTCCTGGAGG + Intergenic
1201323077 Y:12722231-12722253 TACTTACACCTTGTTCTTAAAGG + Intronic