ID: 1083076656

View in Genome Browser
Species Human (GRCh38)
Location 11:60046790-60046812
Sequence AGAGTCCACGAGGATCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083076652_1083076656 1 Left 1083076652 11:60046766-60046788 CCTATCTGCTCAAATCCTGTACC 0: 1
1: 0
2: 1
3: 16
4: 105
Right 1083076656 11:60046790-60046812 AGAGTCCACGAGGATCTAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083076656 Original CRISPR AGAGTCCACGAGGATCTAGA AGG Intronic
903376998 1:22872900-22872922 TGAGACCACGAGGTTCGAGAGGG + Intronic
903952937 1:27006547-27006569 GGAGTCCAGGATGATCTGGAAGG + Exonic
904447406 1:30586387-30586409 ACAGTCCTCAAGGATCTACAAGG - Intergenic
905993123 1:42357190-42357212 AGAGCCCACTAGGAGCTAGAAGG + Intergenic
907810603 1:57866008-57866030 AGAGACCACAGGGATCTAGCTGG - Intronic
914921076 1:151847844-151847866 AGAGTCCACGGGGATCAAGCTGG + Exonic
923470539 1:234286627-234286649 AGAGTCCATGAGGATGATGAGGG + Intronic
924139222 1:241004705-241004727 AGAGGCCAGAAGAATCTAGAGGG - Intronic
1067079244 10:43204063-43204085 CCAGCCCACGAGGATCTCGATGG - Intronic
1067576748 10:47413958-47413980 AGAGGGCAGGAGGCTCTAGAGGG + Intergenic
1069284883 10:66701177-66701199 AGAGTCCATAAAGATCTACATGG - Intronic
1076710577 10:132331775-132331797 AGAGACCGCGAGGGTCTGGAGGG - Intronic
1083076656 11:60046790-60046812 AGAGTCCACGAGGATCTAGAAGG + Intronic
1085440875 11:76561331-76561353 AGAGTCCACAAGGCTGTATACGG - Intergenic
1087356124 11:97097064-97097086 AGAATCCACCAGAATCTTGAAGG + Intergenic
1088139557 11:106599353-106599375 AGAGGCCAAAAGAATCTAGATGG - Intergenic
1091264870 11:134262601-134262623 AGGGTCCACCAGATTCTAGAAGG + Exonic
1091344816 11:134845519-134845541 AGGCTCCAGGAGGGTCTAGATGG + Intergenic
1094782852 12:33812881-33812903 ATATACCAGGAGGATCTAGAGGG + Intergenic
1104010636 12:124927712-124927734 AGTGTCCGCGAGGAGCCAGAGGG - Intergenic
1104126587 12:125852505-125852527 AGACTCCATGAGAATGTAGATGG - Intergenic
1112537371 13:100273282-100273304 AGAGTCCACAAGGAACTCCACGG - Exonic
1113592466 13:111510814-111510836 GGAGTCCACCGGTATCTAGATGG + Intergenic
1120172689 14:81261528-81261550 AGAGACAACGAGGATACAGAGGG + Exonic
1121178254 14:91907030-91907052 AGACACCACATGGATCTAGAAGG + Intronic
1122406806 14:101505651-101505673 AGAGTCTCAGAGGATCTAGCAGG + Intergenic
1126003660 15:44235639-44235661 AGAGTCCAAGAGTATCTAGCTGG + Intergenic
1128319988 15:66686461-66686483 AGGGTCCACAAGGATCCATAAGG + Intergenic
1130411591 15:83653338-83653360 AGGGACCACGAGGATCTTGCAGG - Intergenic
1135054530 16:19219926-19219948 AAAGTCCAGGAGGACCTGGATGG + Intronic
1136014257 16:27384991-27385013 AGATCCCACGAGACTCTAGAGGG - Intergenic
1144373443 17:14615586-14615608 GGAGTTCAGGAGGAGCTAGAGGG - Intergenic
1148289858 17:46435569-46435591 AGAATCTAAGAGGATCTACATGG - Intergenic
1148312026 17:46653141-46653163 AGAATCTAAGAGGATCTACATGG - Intronic
1155868682 18:30998268-30998290 AGAGCCTACAAGTATCTAGATGG + Intronic
1156146262 18:34184408-34184430 AGAGTCAAAGAGCATTTAGAAGG + Intronic
1161407977 19:4101112-4101134 AGAGTTCACGAGGATGTTGGAGG + Exonic
1167703816 19:51066427-51066449 GGAGTCCACGGGGACCTAGGTGG + Intergenic
1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG + Exonic
925644021 2:6017670-6017692 AGAATCCACGAGGAGAAAGAAGG - Intergenic
927400250 2:22703185-22703207 AGAGCCCACAAGGGTCAAGAAGG - Intergenic
928367173 2:30711805-30711827 AGTGTCCAGGAGGAGCCAGAAGG - Intergenic
929799922 2:45091010-45091032 TGATTCCTCAAGGATCTAGAAGG - Intergenic
938997109 2:136691745-136691767 AGACTCCAAGAGGATATAGATGG + Intergenic
944159368 2:196642542-196642564 AGAGTCCCCGAGTATCTGGGAGG - Intronic
945819560 2:214647423-214647445 ATGGACCACCAGGATCTAGAAGG - Intergenic
1173220874 20:41132083-41132105 AGAGAACACGAGGCTCTTGAGGG + Intergenic
1174676957 20:52367380-52367402 ACAGTCCCCCAGGAGCTAGAAGG + Intergenic
1179069562 21:38059026-38059048 AGAATCAAGGAGGAGCTAGAAGG - Intronic
1181408716 22:22703233-22703255 AGAGTCCACCTGGAGCTGGAAGG - Intergenic
1182669513 22:31984122-31984144 AGAGTCCACCAGGACCAAGGGGG - Intergenic
1183253987 22:36748952-36748974 AGAATCCACCATAATCTAGAGGG + Intergenic
954702174 3:52456046-52456068 CCAGTCCTAGAGGATCTAGAGGG - Intronic
961903219 3:130235194-130235216 AGAGTCGACAAGGACCAAGAGGG + Intergenic
962805436 3:138923723-138923745 GCAGTCCTCGAGGATCCAGAGGG + Intergenic
966460104 3:180166689-180166711 AGAGTCCACCAGAATCATGAAGG - Intergenic
968252158 3:197229061-197229083 AGAGTCTACGGGCATCTAGTGGG + Intronic
973676386 4:53268110-53268132 AGAGCCCACGAGTATGAAGAGGG + Intronic
978555792 4:109979231-109979253 AGAGACAAGGAGGAGCTAGAGGG + Intronic
985166177 4:187097094-187097116 GGAGTCCAAGAGGACCTGGAAGG + Intergenic
997411195 5:133692299-133692321 AGAGGCCACAAGGATCTTGGAGG + Intergenic
999709437 5:154303330-154303352 AGAGTCCAAGGAGATCAAGAAGG + Intronic
1006514970 6:34540816-34540838 AGAGTGCACCAGGATCCAGGAGG + Intronic
1008084751 6:47232795-47232817 AGAGTCCAGGAGGGTCTGGCTGG + Exonic
1008832978 6:55791734-55791756 AAAGTCCACGTGGAGCAAGAGGG + Intronic
1009521126 6:64683016-64683038 AGAGAGCATGAGGATATAGAAGG + Intronic
1012860664 6:104555582-104555604 AGAGTTTATGAGAATCTAGAAGG - Intergenic
1016497558 6:144681516-144681538 AGAGTCCAGGAGCAATTAGAAGG + Intronic
1024798875 7:53052517-53052539 AGCGTCCAAGAGAATGTAGAAGG + Intergenic
1032117181 7:129127104-129127126 AGAGTTCACGAGGATGTTGGAGG - Intergenic
1032766854 7:135002274-135002296 AGAGTCCAGGAGAGACTAGATGG + Intronic
1035344862 7:158191279-158191301 GGAGTCCAAGAGGATGCAGAGGG + Intronic
1036551719 8:9821712-9821734 TGATTCCTCAAGGATCTAGAAGG + Intergenic
1042283974 8:67087604-67087626 AGAGTAAAGGAGGACCTAGAGGG + Intronic
1042423393 8:68618767-68618789 AGAGTTCAAATGGATCTAGAGGG + Intronic
1047912685 8:129547602-129547624 AAAGTCCAGCAGGATCTAGAAGG + Intergenic
1048855270 8:138681537-138681559 AGAGGGCATTAGGATCTAGAGGG - Intronic
1049909777 9:254278-254300 AGAGTCCATGAGGGTTTAGGAGG - Intronic
1058935002 9:109762129-109762151 CGATTCCTCAAGGATCTAGAAGG + Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic