ID: 1083081484

View in Genome Browser
Species Human (GRCh38)
Location 11:60098712-60098734
Sequence AATTATTGACAAAAGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083081484_1083081488 4 Left 1083081484 11:60098712-60098734 CCAGCCATCTTTTGTCAATAATT No data
Right 1083081488 11:60098739-60098761 GAATAGAGTTGAAAGGAAACTGG No data
1083081484_1083081487 -3 Left 1083081484 11:60098712-60098734 CCAGCCATCTTTTGTCAATAATT No data
Right 1083081487 11:60098732-60098754 ATTGATGGAATAGAGTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083081484 Original CRISPR AATTATTGACAAAAGATGGC TGG (reversed) Intergenic
No off target data available for this crispr