ID: 1083081487

View in Genome Browser
Species Human (GRCh38)
Location 11:60098732-60098754
Sequence ATTGATGGAATAGAGTTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083081483_1083081487 24 Left 1083081483 11:60098685-60098707 CCAGAAAACAGAATGTAGGGACA No data
Right 1083081487 11:60098732-60098754 ATTGATGGAATAGAGTTGAAAGG No data
1083081485_1083081487 -7 Left 1083081485 11:60098716-60098738 CCATCTTTTGTCAATAATTGATG No data
Right 1083081487 11:60098732-60098754 ATTGATGGAATAGAGTTGAAAGG No data
1083081480_1083081487 30 Left 1083081480 11:60098679-60098701 CCATAGCCAGAAAACAGAATGTA No data
Right 1083081487 11:60098732-60098754 ATTGATGGAATAGAGTTGAAAGG No data
1083081484_1083081487 -3 Left 1083081484 11:60098712-60098734 CCAGCCATCTTTTGTCAATAATT No data
Right 1083081487 11:60098732-60098754 ATTGATGGAATAGAGTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083081487 Original CRISPR ATTGATGGAATAGAGTTGAA AGG Intergenic
No off target data available for this crispr