ID: 1083081488 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:60098739-60098761 |
Sequence | GAATAGAGTTGAAAGGAAAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1083081485_1083081488 | 0 | Left | 1083081485 | 11:60098716-60098738 | CCATCTTTTGTCAATAATTGATG | No data | ||
Right | 1083081488 | 11:60098739-60098761 | GAATAGAGTTGAAAGGAAACTGG | No data | ||||
1083081484_1083081488 | 4 | Left | 1083081484 | 11:60098712-60098734 | CCAGCCATCTTTTGTCAATAATT | No data | ||
Right | 1083081488 | 11:60098739-60098761 | GAATAGAGTTGAAAGGAAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1083081488 | Original CRISPR | GAATAGAGTTGAAAGGAAAC TGG | Intergenic | ||
No off target data available for this crispr |