ID: 1083081488

View in Genome Browser
Species Human (GRCh38)
Location 11:60098739-60098761
Sequence GAATAGAGTTGAAAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083081485_1083081488 0 Left 1083081485 11:60098716-60098738 CCATCTTTTGTCAATAATTGATG No data
Right 1083081488 11:60098739-60098761 GAATAGAGTTGAAAGGAAACTGG No data
1083081484_1083081488 4 Left 1083081484 11:60098712-60098734 CCAGCCATCTTTTGTCAATAATT No data
Right 1083081488 11:60098739-60098761 GAATAGAGTTGAAAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083081488 Original CRISPR GAATAGAGTTGAAAGGAAAC TGG Intergenic
No off target data available for this crispr