ID: 1083083206

View in Genome Browser
Species Human (GRCh38)
Location 11:60114690-60114712
Sequence GGGTGCTGGGACACAGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083083206_1083083219 26 Left 1083083206 11:60114690-60114712 CCCTGGGCTGTGTCCCAGCACCC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083206_1083083220 27 Left 1083083206 11:60114690-60114712 CCCTGGGCTGTGTCCCAGCACCC No data
Right 1083083220 11:60114740-60114762 CTGAAAAAAAATGCATTAGTGGG No data
1083083206_1083083213 -6 Left 1083083206 11:60114690-60114712 CCCTGGGCTGTGTCCCAGCACCC No data
Right 1083083213 11:60114707-60114729 GCACCCCAGGGGCAGCATGCAGG No data
1083083206_1083083217 3 Left 1083083206 11:60114690-60114712 CCCTGGGCTGTGTCCCAGCACCC No data
Right 1083083217 11:60114716-60114738 GGGCAGCATGCAGGACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083083206 Original CRISPR GGGTGCTGGGACACAGCCCA GGG (reversed) Intergenic