ID: 1083083207

View in Genome Browser
Species Human (GRCh38)
Location 11:60114691-60114713
Sequence GGGGTGCTGGGACACAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083083207_1083083220 26 Left 1083083207 11:60114691-60114713 CCTGGGCTGTGTCCCAGCACCCC No data
Right 1083083220 11:60114740-60114762 CTGAAAAAAAATGCATTAGTGGG No data
1083083207_1083083219 25 Left 1083083207 11:60114691-60114713 CCTGGGCTGTGTCCCAGCACCCC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083207_1083083217 2 Left 1083083207 11:60114691-60114713 CCTGGGCTGTGTCCCAGCACCCC No data
Right 1083083217 11:60114716-60114738 GGGCAGCATGCAGGACCAGCAGG No data
1083083207_1083083213 -7 Left 1083083207 11:60114691-60114713 CCTGGGCTGTGTCCCAGCACCCC No data
Right 1083083213 11:60114707-60114729 GCACCCCAGGGGCAGCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083083207 Original CRISPR GGGGTGCTGGGACACAGCCC AGG (reversed) Intergenic