ID: 1083083212

View in Genome Browser
Species Human (GRCh38)
Location 11:60114704-60114726
Sequence GCATGCTGCCCCTGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083083212_1083083220 13 Left 1083083212 11:60114704-60114726 CCAGCACCCCAGGGGCAGCATGC No data
Right 1083083220 11:60114740-60114762 CTGAAAAAAAATGCATTAGTGGG No data
1083083212_1083083219 12 Left 1083083212 11:60114704-60114726 CCAGCACCCCAGGGGCAGCATGC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083212_1083083221 18 Left 1083083212 11:60114704-60114726 CCAGCACCCCAGGGGCAGCATGC No data
Right 1083083221 11:60114745-60114767 AAAAAATGCATTAGTGGGATTGG No data
1083083212_1083083222 19 Left 1083083212 11:60114704-60114726 CCAGCACCCCAGGGGCAGCATGC No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083083212 Original CRISPR GCATGCTGCCCCTGGGGTGC TGG (reversed) Intergenic