ID: 1083083219

View in Genome Browser
Species Human (GRCh38)
Location 11:60114739-60114761
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083083215_1083083219 5 Left 1083083215 11:60114711-60114733 CCCAGGGGCAGCATGCAGGACCA No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083214_1083083219 6 Left 1083083214 11:60114710-60114732 CCCCAGGGGCAGCATGCAGGACC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083207_1083083219 25 Left 1083083207 11:60114691-60114713 CCTGGGCTGTGTCCCAGCACCCC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083211_1083083219 13 Left 1083083211 11:60114703-60114725 CCCAGCACCCCAGGGGCAGCATG No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083216_1083083219 4 Left 1083083216 11:60114712-60114734 CCAGGGGCAGCATGCAGGACCAG No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083206_1083083219 26 Left 1083083206 11:60114690-60114712 CCCTGGGCTGTGTCCCAGCACCC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data
1083083212_1083083219 12 Left 1083083212 11:60114704-60114726 CCAGCACCCCAGGGGCAGCATGC No data
Right 1083083219 11:60114739-60114761 TCTGAAAAAAAATGCATTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083083219 Original CRISPR TCTGAAAAAAAATGCATTAG TGG Intergenic