ID: 1083083222

View in Genome Browser
Species Human (GRCh38)
Location 11:60114746-60114768
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083083218_1083083222 -8 Left 1083083218 11:60114731-60114753 CCAGCAGGTCTGAAAAAAAATGC No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data
1083083215_1083083222 12 Left 1083083215 11:60114711-60114733 CCCAGGGGCAGCATGCAGGACCA No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data
1083083211_1083083222 20 Left 1083083211 11:60114703-60114725 CCCAGCACCCCAGGGGCAGCATG No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data
1083083212_1083083222 19 Left 1083083212 11:60114704-60114726 CCAGCACCCCAGGGGCAGCATGC No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data
1083083216_1083083222 11 Left 1083083216 11:60114712-60114734 CCAGGGGCAGCATGCAGGACCAG No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data
1083083214_1083083222 13 Left 1083083214 11:60114710-60114732 CCCCAGGGGCAGCATGCAGGACC No data
Right 1083083222 11:60114746-60114768 AAAAATGCATTAGTGGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083083222 Original CRISPR AAAAATGCATTAGTGGGATT GGG Intergenic