ID: 1083083813

View in Genome Browser
Species Human (GRCh38)
Location 11:60121921-60121943
Sequence AAACCCTGCTTCATAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083083813_1083083815 20 Left 1083083813 11:60121921-60121943 CCTATCTTTATGAAGCAGGGTTT No data
Right 1083083815 11:60121964-60121986 AATGATATTACAGAGTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083083813 Original CRISPR AAACCCTGCTTCATAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr