ID: 1083092825

View in Genome Browser
Species Human (GRCh38)
Location 11:60218612-60218634
Sequence GAGGAGAAGGCCATCACTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083092825_1083092831 29 Left 1083092825 11:60218612-60218634 CCGATAGTGATGGCCTTCTCCTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1083092831 11:60218664-60218686 CTCCTTAGGACCCACTCCCAAGG 0: 1
1: 0
2: 4
3: 19
4: 239
1083092825_1083092830 15 Left 1083092825 11:60218612-60218634 CCGATAGTGATGGCCTTCTCCTC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1083092830 11:60218650-60218672 AGACAATGTTGATTCTCCTTAGG 0: 2
1: 21
2: 143
3: 205
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083092825 Original CRISPR GAGGAGAAGGCCATCACTAT CGG (reversed) Intronic
901384310 1:8897188-8897210 GATGAGAAGGCATTCACTAGTGG - Intergenic
906114427 1:43346909-43346931 CAGGAGAAGGCCATCAGGACTGG + Exonic
906350749 1:45056808-45056830 GAGGAGAAGGCAAACCATATGGG + Intronic
907289068 1:53401303-53401325 GAGGAGAAGGGGTTCACTGTAGG + Intergenic
907595301 1:55714028-55714050 GAGGAGGAAGCCACCATTATTGG - Intergenic
907842858 1:58173482-58173504 GATGAGAAGGCATTCACTAGTGG - Intronic
908168048 1:61477501-61477523 GAGGATAAGGCCCTCATGATGGG - Intergenic
909109757 1:71459824-71459846 AAGGATAAGGAAATCACTATGGG - Intronic
909917272 1:81336074-81336096 TAAGTGAAGGCCATCACAATGGG - Intronic
912262866 1:108126589-108126611 GAGGAGAAGGCCATCAGTAAAGG + Intergenic
912330242 1:108813616-108813638 GAGGAGATGGCCAAGACTACAGG + Intergenic
913383164 1:118231755-118231777 GATGAGAAGGCATTCACTAGTGG - Intergenic
914266589 1:146043294-146043316 GAGGAGACAGCAAACACTATGGG + Intergenic
914520181 1:148408223-148408245 GAGGAGACAGCAAACACTATGGG - Intergenic
916204409 1:162301337-162301359 TAGGGGAAGGACATCACCATGGG - Intronic
924268362 1:242305930-242305952 GAGGAGAAGGTCCTCACAACTGG + Intronic
924373600 1:243383010-243383032 GAGGAGAAGGTCATGACTAGAGG + Intronic
1066444158 10:35466437-35466459 GAGGAGCAGGCCAGCTCTGTAGG + Intronic
1066613816 10:37276972-37276994 GATGAGAAGGCATTCACTAGTGG + Intronic
1068501084 10:57840442-57840464 GATGAGAAGGCATTCACTAGTGG - Intergenic
1069410420 10:68147673-68147695 GAGGGGAAGGCCATCTCTCTCGG - Intronic
1080679182 11:34458197-34458219 CAGGAGAAGGACATGAGTATAGG + Intronic
1083092825 11:60218612-60218634 GAGGAGAAGGCCATCACTATCGG - Intronic
1084372935 11:68756531-68756553 GAGGAGAAGGCCATCCCTTGGGG + Exonic
1085808510 11:79658767-79658789 GAGGACAAGGCCCTCATCATGGG - Intergenic
1086054127 11:82627617-82627639 GATGAGAAGGCATTCACCATTGG - Intergenic
1087682572 11:101232989-101233011 GATGAGAAGGCATTCACTAGTGG + Intergenic
1088493065 11:110405365-110405387 GATGAGAAGGCATTCACTAGTGG - Intergenic
1088920061 11:114254250-114254272 GAGGAGGAGGCCATGAATATGGG + Intergenic
1091669227 12:2440545-2440567 GAGGAGGAGGCCTTCAGTGTGGG + Intronic
1092161382 12:6317244-6317266 GGGGAGAAGGCCATGAATACAGG - Intronic
1093346031 12:18038952-18038974 GATGAGAAGGCATTCACTAGTGG - Intergenic
1094604689 12:31940223-31940245 GAGAAGAGGGCCATAGCTATGGG - Intergenic
1097180885 12:57171243-57171265 GAGGAGCAGGGTGTCACTATTGG + Intronic
1101705382 12:107216162-107216184 GATGAGAAGGCATTCACTAGTGG - Intergenic
1104768100 12:131343618-131343640 GATGAGAAGGCATTCACTAGTGG + Intergenic
1104846567 12:131850107-131850129 CAGGAGAGGGGCATCACTACAGG + Intronic
1110121255 13:71884620-71884642 TAGGAGACTGCCATCACAATGGG + Intergenic
1115138436 14:30140095-30140117 GAGGAGAGGACCATCACTAGGGG - Intronic
1116698127 14:48202213-48202235 GATGAGAAGGCATTCACTAGTGG - Intergenic
1117896425 14:60492245-60492267 GAGAAAAAGGCCATAACTTTAGG - Intronic
1118634316 14:67733906-67733928 AAGGAGAAGGCCAACCCTAAAGG + Exonic
1124912671 15:33937667-33937689 GAGGACAGGGCCTTCACAATGGG + Intronic
1125994015 15:44138956-44138978 GGGGAGTAGGCCAGCACTGTTGG + Intronic
1129907833 15:79201995-79202017 GGTGAGCAGGCCATCACTGTGGG + Intergenic
1131411745 15:92213233-92213255 GATGAGAAGGCATTCACTAGTGG - Intergenic
1131446212 15:92499815-92499837 GAGGAGAAGGCAGGCAATATGGG - Intronic
1131756327 15:95566801-95566823 GAGGAGAAAGCCATTATCATAGG + Intergenic
1138494064 16:57396552-57396574 GATGAGAAGGCATTCACTAGTGG + Intergenic
1140121274 16:72085073-72085095 GAGGAGGAGGCCATCACCTCTGG - Exonic
1146311276 17:31770223-31770245 GATGAGAAGGCATTCACTAGTGG - Intergenic
1147960079 17:44162004-44162026 GAGAAGAAGGCCAGCATGATTGG + Exonic
1149074492 17:52579621-52579643 GATGAGAAGGCATTCACTAGTGG - Intergenic
1149213812 17:54331387-54331409 GATGAGAAGGCACTCACTAGTGG - Intergenic
1149457241 17:56797784-56797806 GAGGAGAAGGCCAGCCCTAAAGG - Intronic
1152896520 17:82914422-82914444 GTGGAGAAGGGCATCTTTATGGG + Intronic
1155475531 18:26233323-26233345 GAGGAGAAGGCATTCACTAGCGG + Intronic
1158268696 18:55688633-55688655 AAGGAGAAGGCCATGACTTAGGG - Intergenic
1158702441 18:59760576-59760598 GAGGAGAGGGCCCTCACTCAGGG - Intergenic
1160498244 18:79387730-79387752 GAGGTGAAGGCCGTTACTATTGG + Intergenic
1161875420 19:6904885-6904907 GAGGAGAAGGACTTCTCTAGAGG + Intronic
1163226227 19:15963300-15963322 CAGGAGGATGCCATCACTGTGGG + Intergenic
1163455985 19:17405939-17405961 GAGGCAGAGGCCATCACTGTTGG + Intronic
1164625154 19:29723034-29723056 GAGGGGAAGACCTTCACTGTTGG - Intergenic
1165991647 19:39818603-39818625 GAGCAGACAGTCATCACTATAGG + Intergenic
927486409 2:23491385-23491407 CAGGAGAAAGCCATCACTACAGG - Intronic
934920073 2:98335928-98335950 TAGGAGGAGGCCATGACTCTTGG + Intronic
937345410 2:121122591-121122613 CAGGAGAAGGCCACCACGATTGG + Intergenic
938646788 2:133339605-133339627 AAGGAGAAGGCCATCTGTCTTGG - Intronic
939852408 2:147317594-147317616 GATGAGAAGGCATTCACTAGTGG - Intergenic
939888081 2:147703134-147703156 GAGGAGATGGCCATCAAAAGGGG - Intergenic
945028312 2:205640379-205640401 GTAGAGAAGGCCATCAATAAGGG - Intergenic
945271447 2:207944385-207944407 GAGGAGAAGACCATGAATACAGG + Intronic
1173292899 20:41729900-41729922 GAGGGGAAGGCCATCCCTGATGG + Intergenic
1174174351 20:48635680-48635702 GGGGAGAAGGCAATCTCTACAGG - Intronic
1180860587 22:19078542-19078564 GAAGAGAAAGCCATCAAAATTGG - Intronic
949491543 3:4594308-4594330 GGGGAAAAGCCCATCACGATGGG - Intronic
949761822 3:7479201-7479223 GATGAGGAGGCTATCACTCTGGG + Intronic
954106107 3:48410605-48410627 GAGGAGATGGGCTCCACTATGGG - Intronic
954462687 3:50636736-50636758 GAGGAGAAGGCTCTGGCTATGGG + Intronic
954930992 3:54281125-54281147 GAGGAGGAGGACAGCACCATGGG + Intronic
961359838 3:126360254-126360276 GAGGAGAAGTCAGTCACTGTGGG - Intergenic
964455177 3:156856882-156856904 GAGGAAAAGGGTATAACTATTGG - Intronic
964904068 3:161696218-161696240 GAGGGTAAGGCCATCATGATGGG + Intergenic
965423570 3:168493529-168493551 GAGAAGATGGCCAACAGTATTGG + Intergenic
970742118 4:19250940-19250962 GTGGAGATGCCCAACACTATGGG + Intergenic
974527299 4:63060588-63060610 GATGAGAAGGCATTCACTAGTGG - Intergenic
975000360 4:69218314-69218336 AAGGAGAATCCTATCACTATTGG + Intergenic
975005403 4:69276891-69276913 AAGGAGAATCCTATCACTATTGG - Intergenic
975015082 4:69405227-69405249 AAGGAGAATCCTATCACTATTGG - Intronic
978934840 4:114361644-114361666 GAGGATAAACCCATCACTCTTGG + Intergenic
984773718 4:183461722-183461744 GAGCAGTAGGCCATACCTATAGG - Intergenic
985528802 5:421721-421743 GAGGAGGTGGCCCTCACTAAAGG - Intronic
995707175 5:114998055-114998077 GATGAGAAGGCATTCACTAGTGG - Intergenic
996402922 5:123082861-123082883 GAAGAGAAAGCCATCCCTTTAGG - Intergenic
997073052 5:130640700-130640722 GATGAGAAGGCGTTCACTAGTGG - Intergenic
998661767 5:144246720-144246742 GAGGAGAAGGAGATCAATAAAGG - Intronic
998713109 5:144849126-144849148 GATGAGAAGGCATTCACTAGTGG + Intergenic
1000171351 5:158705840-158705862 GAAGAAAAGGCCCCCACTATTGG - Intronic
1002478341 5:179482797-179482819 GAGGAGAAGGGCAGAACTCTGGG - Intergenic
1002777284 6:339945-339967 GAGCAGGAGAACATCACTATGGG - Intronic
1008899873 6:56599719-56599741 GAGGAAATAGCCATCACTTTGGG - Intronic
1009388532 6:63116445-63116467 GAGGGGAAGCCTATCACCATTGG - Intergenic
1009494182 6:64328431-64328453 GGGAAGAAGGCCACCAATATTGG + Intronic
1011374306 6:86673627-86673649 GATGAGAAGGCATTCACTAGTGG + Intergenic
1012027437 6:94014739-94014761 AAGAAGAAGGAAATCACTATAGG - Intergenic
1013622363 6:111902271-111902293 GAGGAGAAGGTCATCACAGAAGG - Intergenic
1015811409 6:137165188-137165210 GAGAAAAAGGCCACCAATATCGG + Intronic
1017101707 6:150854779-150854801 GATGAGAAGGCATTCACTAGTGG - Intergenic
1022797028 7:33739881-33739903 GAGGAGAGGGCCAGAACTCTGGG + Intergenic
1026953774 7:74364283-74364305 GAGGAGGAGTCCATCACCAAGGG + Exonic
1027725030 7:81793663-81793685 CAGGAAAAGGCCACCACAATTGG + Intergenic
1027791784 7:82644212-82644234 GATGAGAAGGCATTCACTAGTGG - Intergenic
1028494496 7:91448606-91448628 GATGAGAAGGCATTCACTAGTGG + Intergenic
1030333697 7:108300306-108300328 TTGAAGAAGGCCATCACCATTGG + Intronic
1031316275 7:120261400-120261422 GACGAGGAAGGCATCACTATTGG + Intergenic
1032777526 7:135129133-135129155 GAGGAGAAGGCAGTCATAATAGG - Intronic
1035254652 7:157618605-157618627 GAGGAGGCGGCCATCTCTCTGGG + Exonic
1036952069 8:13150159-13150181 GAGAAGAAAGACAGCACTATGGG + Intronic
1039992331 8:42498954-42498976 GAGCAGAAGGCTATCCCTCTAGG + Intronic
1040649674 8:49433885-49433907 GATGAGAAGGCATTCACTAGTGG - Intergenic
1041002666 8:53467328-53467350 GATGAGAAGGCATTCACTAGTGG - Intergenic
1042335372 8:67624722-67624744 AAGGAGAAGCCCATCTCTATGGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1044831576 8:96255167-96255189 GAGGAGAAGACTATCAAGATAGG + Intronic
1046411825 8:113855004-113855026 GAGGATGAGGCTATCAATATAGG - Intergenic
1048224252 8:132569433-132569455 AAGGAGAAGGCTATAAATATCGG + Intergenic
1049105291 8:140608909-140608931 GAGGAGCAGGACCTCACCATGGG - Intronic
1051718530 9:20010280-20010302 GAGGAGAAGGCCACCTCTCCTGG - Intergenic
1051842959 9:21419160-21419182 GAGGAAGAGGCCATCACTGAGGG + Intronic
1056392035 9:86149545-86149567 GATGAGAAGGCATTCACTAGTGG + Intergenic
1056714029 9:89013846-89013868 GTGGAGGAGGCCATGCCTATAGG - Intronic
1062113313 9:134794541-134794563 GAGGAGAAGCCGATGACTCTTGG + Intronic
1062281351 9:135753273-135753295 GAGGAGCTGGCCATCACCAGGGG + Intronic
1188106342 X:26152000-26152022 GAGGAAGAGGCCCTCACAATGGG + Intergenic
1191888281 X:65912639-65912661 GAGCTGAAGGCCATTATTATTGG - Intergenic
1195138839 X:101938342-101938364 GAGGAGAAAGCTATCATTCTGGG + Intergenic
1198418731 X:136447679-136447701 CAGGAGATAGCCATGACTATTGG - Intergenic
1199409437 X:147503491-147503513 GAGGAGGAGGTCTTGACTATGGG - Intergenic
1201404448 Y:13635664-13635686 GATGAGAAGGCACTCACTAATGG - Intergenic
1201430292 Y:13895939-13895961 GATGAGAAGGCATTCACTAGTGG - Intergenic
1201468888 Y:14313186-14313208 GATGAGAAGGCATTCACTAGTGG - Intergenic
1201495929 Y:14591450-14591472 GATGAGAAGGCATTCACTAGTGG + Intronic
1201572796 Y:15432539-15432561 GATGAGAAGGCATTCACTAGTGG - Intergenic
1201631931 Y:16078975-16078997 GATGAGAAGGCATTCACTAGTGG - Intergenic
1202243546 Y:22793753-22793775 GATGAGAAGGCATTCACTAGTGG - Intergenic
1202396533 Y:24427503-24427525 GATGAGAAGGCATTCACTAGTGG - Intergenic
1202474250 Y:25242589-25242611 GATGAGAAGGCATTCACTAGTGG + Intergenic