ID: 1083094158

View in Genome Browser
Species Human (GRCh38)
Location 11:60232886-60232908
Sequence GGGGCATGGAGCAGTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083094158_1083094161 -8 Left 1083094158 11:60232886-60232908 CCCATGGAACTGCTCCATGCCCC 0: 1
1: 0
2: 0
3: 12
4: 139
Right 1083094161 11:60232901-60232923 CATGCCCCCATCTTAGTCGCTGG 0: 1
1: 1
2: 0
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083094158 Original CRISPR GGGGCATGGAGCAGTTCCAT GGG (reversed) Intronic