ID: 1083100280

View in Genome Browser
Species Human (GRCh38)
Location 11:60297625-60297647
Sequence GTGGCTTATCATTTCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 107, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083100277_1083100280 26 Left 1083100277 11:60297576-60297598 CCAGAATGGCTTAAACATTGGAA 0: 1
1: 0
2: 2
3: 18
4: 187
Right 1083100280 11:60297625-60297647 GTGGCTTATCATTTCTAGGATGG 0: 1
1: 0
2: 2
3: 107
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083100280 Original CRISPR GTGGCTTATCATTTCTAGGA TGG Intronic
906766617 1:48440083-48440105 GAGGCTTATCTTTAATAGGAAGG - Intronic
909219886 1:72943948-72943970 ATGGCTTCTCATTTCTAGTGAGG + Intergenic
909359476 1:74744115-74744137 GAGGCTTATCATTAATAGGAAGG + Intronic
910040924 1:82850895-82850917 GTGGCTTACCATTACTCTGAGGG - Intergenic
911298910 1:96150004-96150026 GAGGCTTATCATTAATAGGAAGG - Intergenic
911548826 1:99254906-99254928 GTGGTTTTTCATATCCAGGAAGG + Intergenic
911751351 1:101500966-101500988 GAGGCTTATCATTAATAGGAAGG - Intergenic
911845685 1:102748011-102748033 GAGGCTTATCATTAATAGGAAGG + Intergenic
912021236 1:105111115-105111137 GAGGCTTATCATTAATAGGAAGG - Intergenic
913469454 1:119174390-119174412 GAGGATTATCATTAATAGGAAGG - Intergenic
913713443 1:121510653-121510675 GAGGCTTATCATTAATAGGAAGG - Intergenic
915227749 1:154423206-154423228 GTGAGTTAGGATTTCTAGGAAGG - Intronic
915260502 1:154673582-154673604 GAGGATTATCATTAATAGGAAGG - Intergenic
915365238 1:155311499-155311521 GAGGCTTTTCATTTGCAGGAGGG + Intronic
915688111 1:157656970-157656992 GTGTCCAATCATTTATAGGATGG - Intergenic
916083564 1:161252224-161252246 GAGGCTTATCATTAGTAGGAAGG - Intergenic
917227516 1:172800489-172800511 GAGGCTTATCATTAATAGGAAGG - Intergenic
917281088 1:173378789-173378811 GAGGCTTATCATTAATAGGAAGG - Intergenic
917545267 1:175960458-175960480 CTGGCTTAGCAGTTCAAGGAAGG + Intronic
917676215 1:177321709-177321731 GAGGCTTATCATTAATAGGAAGG - Intergenic
918750236 1:188261635-188261657 GAGGCTTATCATTAATAGGAAGG + Intergenic
919206229 1:194424090-194424112 GAGGCTTATCATCAATAGGAAGG - Intergenic
919558589 1:199092351-199092373 CAGGCTTATCATTAATAGGAAGG - Intergenic
921019638 1:211224280-211224302 GAGGCTTATCATTAATAGGAAGG - Intergenic
922181462 1:223237219-223237241 ATTGCTTATTAGTTCTAGGAGGG + Intronic
923836985 1:237622829-237622851 GTGGCTTTTCATCTCTATGGAGG + Intronic
1063321766 10:5058142-5058164 GAGGATTATCATTAATAGGAAGG + Intronic
1063414736 10:5864256-5864278 GAGGCTTATCATTAATAGGAAGG - Intronic
1063621746 10:7655671-7655693 GTCTCTTCTCTTTTCTAGGATGG - Exonic
1063859149 10:10289626-10289648 GAGGTTTATCATTAATAGGAAGG + Intergenic
1064149241 10:12849170-12849192 GTGGCTCTTCAATGCTAGGATGG - Intergenic
1065082350 10:22140889-22140911 GAGGCTTATCATTAATAGGAAGG - Intergenic
1066614631 10:37282539-37282561 GAGGCTTATCACTAATAGGAAGG + Intronic
1068500252 10:57834773-57834795 GAGGCTTATCATTAATAGGAAGG - Intergenic
1068582214 10:58754625-58754647 GTGTCTCATCATTTCTGGGGTGG + Intronic
1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG + Intergenic
1069365145 10:67688342-67688364 GAGGCTTATCATTAATAGGAAGG + Intronic
1069586719 10:69610274-69610296 ATGGCTTATTATTTCCAGGAGGG - Intergenic
1071834801 10:89408457-89408479 GAGGCTTATCATTAATAGGAAGG - Intronic
1074576481 10:114674581-114674603 TTGCCTTAACAGTTCTAGGAAGG - Intronic
1074612981 10:115039137-115039159 GAGGCTTATCATTAATAGGAAGG - Intergenic
1074742701 10:116500352-116500374 GAGGCTTATCATTAATAGGAAGG + Intergenic
1075146278 10:119885607-119885629 GAGGCTTATCATTAATAGGAAGG - Intronic
1075320811 10:121490474-121490496 GTAGCGTATCATTTGTAGAAAGG - Intronic
1079731278 11:23939497-23939519 GAGGATTATCATTAATAGGAAGG + Intergenic
1079811713 11:25005218-25005240 GAGGCTTATCATTAATAGGAGGG + Intronic
1080202343 11:29687303-29687325 GTGGCTTTGCATTTCCAGGCTGG + Intergenic
1081033377 11:38113574-38113596 TAGGCTTATCATTAATAGGAAGG - Intergenic
1081145951 11:39562779-39562801 GAGTCTTATCATTAATAGGAAGG - Intergenic
1083100280 11:60297625-60297647 GTGGCTTATCATTTCTAGGATGG + Intronic
1083240630 11:61385347-61385369 GTGTCTTATCATTTGGGGGAAGG - Intergenic
1084210949 11:67622114-67622136 GAGGATTATCATTAATAGGAAGG - Intergenic
1085216330 11:74836010-74836032 GTGGCTTCTCCTTGCTAGAATGG - Exonic
1087074953 11:94120264-94120286 GAGGCTTATCATTAATACGAAGG - Intergenic
1087319212 11:96638475-96638497 GAGGTTTATCATTAATAGGAAGG - Intergenic
1087459048 11:98422913-98422935 GAGGCTTATCATTAATAGGAAGG + Intergenic
1087683381 11:101238585-101238607 GAGGATTATCATTAATAGGAAGG + Intergenic
1091573960 12:1715092-1715114 GAGGCTTATCATTAATAGGAAGG + Intronic
1092472250 12:8790353-8790375 GAGGATTATCATTCATAGGAAGG - Intergenic
1093558177 12:20503792-20503814 GTGGTTTATAAATTCTAGGGTGG - Intronic
1093580618 12:20781207-20781229 GAGGATTATCATTAATAGGAAGG + Intergenic
1094320015 12:29173335-29173357 GAGGCTTATCATTAATAGGAAGG + Intronic
1094338155 12:29383674-29383696 GAGGATTATCATTAATAGGAAGG + Intergenic
1095195835 12:39315854-39315876 CTTGCTTAGAATTTCTAGGAAGG + Intronic
1095665611 12:44794151-44794173 GTAGCTTACTATTACTAGGAGGG - Intronic
1097428253 12:59472947-59472969 GAGGCTTATCATTAATAGGAAGG - Intergenic
1099414786 12:82372377-82372399 GAGGCTTATCATTAATAGGAAGG + Intronic
1099780390 12:87187403-87187425 CTGGCTTCTCATTTCTAGAGTGG - Intergenic
1100050819 12:90446294-90446316 GAGGCTTATCATTAATAGGAAGG + Intergenic
1100209741 12:92388670-92388692 GAGGCTTATCATTAATAGGAAGG - Intergenic
1100784822 12:98067770-98067792 GTGGCAAGTTATTTCTAGGAAGG + Intergenic
1101704835 12:107211931-107211953 GAGGCTTATCATTAATAGGAAGG - Intergenic
1101779614 12:107823800-107823822 GAGGCTTATCATTAATAGGAAGG - Intergenic
1104767052 12:131336936-131336958 GAGGCTTATCATTAATAGGAAGG - Intergenic
1105762435 13:23526914-23526936 GAGGATTATCATTAATAGGAAGG - Intergenic
1106596072 13:31139190-31139212 GTAGCTAATCTTATCTAGGAAGG + Intronic
1108442114 13:50465274-50465296 GTAGCTCATCATTTCCTGGAGGG - Intronic
1109424258 13:62150878-62150900 GAGTCTTATCATTAATAGGAAGG - Intergenic
1109500989 13:63235961-63235983 GAGGCTTATCATTAATAGGAAGG - Intergenic
1111372484 13:87335597-87335619 GAGGCTTATCATTAATAGGAAGG - Intergenic
1112107644 13:96259260-96259282 GTGCCTTATCATGTCTTGAAAGG - Intronic
1112519072 13:100080357-100080379 GAGGATTATCATTCATAGGAAGG - Intergenic
1112538321 13:100282873-100282895 GAGGATTATCATTCATAGGAAGG - Intronic
1113203969 13:107895234-107895256 GAGGCTTATCATTAATAGGAAGG + Intergenic
1113551551 13:111196690-111196712 GAGGCTTATCATTAATAGGAAGG + Intronic
1120198744 14:81515076-81515098 GAGGCTTATCATTAATAGGAAGG - Intronic
1122376646 14:101265239-101265261 TTAGCTTATTATTTCTAGCAAGG + Intergenic
1126086071 15:45012333-45012355 GAGGCTCATCATTAATAGGAAGG - Intergenic
1128710732 15:69869530-69869552 GTGGCTAATCTCATCTAGGAAGG + Intergenic
1130755713 15:86760838-86760860 GTGGCTTTTCCTCTCTAGGGTGG - Intronic
1131411157 15:92209377-92209399 GAGGCTTATCATTAATAGGAAGG - Intergenic
1134664584 16:16009657-16009679 GTGGCTGATCATTTGAAGGCTGG + Intronic
1134888256 16:17814560-17814582 TTGGCTTATACTTTCTAGTAAGG - Intergenic
1135339724 16:21635372-21635394 GAGGATTATCATTAATAGGAGGG + Intronic
1136634945 16:31514758-31514780 GTGGCTTATCATTACTTTTATGG + Intergenic
1140291991 16:73668050-73668072 GTGACTTATCATTTTCAAGAAGG - Intergenic
1140489074 16:75318945-75318967 GTGCCTTCTCATTTCTAGAAAGG - Intronic
1142512410 17:404989-405011 GTAGCTGATCATTTCCACGAAGG + Intergenic
1142762914 17:2051842-2051864 GTTGCTCATCATTTCTGGGGAGG - Intergenic
1145804053 17:27713889-27713911 GAGGCTTATCATTAATAGGAAGG - Intergenic
1146310457 17:31764552-31764574 GAGGCTTATCACTAATAGGAAGG - Intergenic
1149209616 17:54288308-54288330 GAGGCTTATCATTAATAGGAAGG - Intergenic
1149553004 17:57553945-57553967 TAGGCTTAACAATTCTAGGAGGG + Intronic
1151567961 17:74910427-74910449 GAGGATTATCATTCATAGGAAGG - Intergenic
1152365596 17:79854596-79854618 GTGGCTTGTCATCTCTAGGTTGG + Intergenic
1153437999 18:5087527-5087549 GAGGCTTATCATTAATAGGAAGG - Intergenic
1155476171 18:26237550-26237572 GAGGCTTATCATTAATAGGAAGG + Intronic
1155496127 18:26444646-26444668 ATGTCTCATCATTTCTAGGTTGG + Intergenic
1156777135 18:40805330-40805352 GTGGCAAATTATTTCTAGGATGG + Intergenic
1157094018 18:44670247-44670269 GTGGCTTATAATATTAAGGATGG + Intergenic
1157373234 18:47137908-47137930 GTGGCTTAGCACTTTTGGGAAGG + Intronic
1157923163 18:51734386-51734408 GAGGTTTATCACTTCTAGGTTGG - Intergenic
1158372531 18:56825132-56825154 GTGCCTCCTCGTTTCTAGGATGG + Intronic
1158965146 18:62616150-62616172 ATGGCTAATCATTTCTAGAATGG + Intergenic
1160170805 18:76552504-76552526 TTGTCTTTTCATTTTTAGGATGG - Intergenic
1163679764 19:18674254-18674276 GTGGCCCATGATTTCTGGGAGGG + Intergenic
1164993000 19:32698024-32698046 GAGGATTATCATTAATAGGAAGG + Intronic
930500266 2:52207504-52207526 GTGGCTAATCATGTTTTGGATGG - Intergenic
931540427 2:63324315-63324337 GAGGCTTATCATTAATAGGAGGG - Intronic
933342094 2:81037328-81037350 GAGGCTTATCATTAATAGGAAGG - Intergenic
934867061 2:97823170-97823192 GAGGCTTATCATTAATAGGAAGG - Intronic
939851797 2:147313455-147313477 GAGGCTTATCATTAATAGGAAGG - Intergenic
941200357 2:162501205-162501227 GTCCCTTATTATTTCTAGCAAGG + Intronic
941243353 2:163068829-163068851 GAGGCTTATCATTAATAGGAAGG - Intergenic
942130930 2:172878412-172878434 GAGTCTGTTCATTTCTAGGAAGG + Intronic
942598406 2:177615304-177615326 GTGGTTCATCATTTTTTGGAAGG + Exonic
944728935 2:202498985-202499007 GAGGATTATCATTAATAGGAAGG - Intronic
948625688 2:239266577-239266599 GTGGCTTATAATTTCCCAGAGGG - Intronic
1169836476 20:9885375-9885397 ATGTCTTATTATTTCTAAGAAGG - Intergenic
1170153628 20:13250182-13250204 GAGGCTTAGGATTTCTGGGATGG + Intronic
1171261450 20:23737998-23738020 GAGGCTTATTATTAATAGGAAGG - Intergenic
1171270586 20:23813889-23813911 GAGGCTTATCATTAATAGGAAGG - Intergenic
1172340588 20:34154502-34154524 GAGGATTATCATTAATAGGAAGG - Intergenic
1175549695 20:59809080-59809102 GGGGCTTTTCATTTCGAGGAAGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177731297 21:25029923-25029945 CTGGCTTTTCATTTCTAGAGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1180570077 22:16706674-16706696 GTGGCTTATCTTATAGAGGAAGG - Intergenic
1182336230 22:29585363-29585385 GGGTCTTAGCATTTCTAAGAAGG + Intergenic
1184842587 22:47061119-47061141 GTGGCTCAACCTTTCCAGGACGG - Intronic
949449032 3:4165448-4165470 GAGGCTTATCATTAACAGGAAGG + Intronic
951020424 3:17776540-17776562 GAGGCTTATCATTAATAGGAAGG - Intronic
951239402 3:20271751-20271773 GAGGCTTGTCATTAATAGGAAGG - Intergenic
951288915 3:20851511-20851533 GTGATTTATCATTTCTAAAATGG + Intergenic
952452962 3:33448716-33448738 GAGGCTTATCATTAATAGGAAGG - Intergenic
952555113 3:34522233-34522255 GAGGCTTATCATTAATAGGAAGG + Intergenic
952941011 3:38444377-38444399 GAGGCTTATCATTAATAGGAAGG + Intergenic
953623007 3:44548834-44548856 GAGGCTTATCATTAATAGGAAGG + Intergenic
954232333 3:49227002-49227024 GAGGCTTCTCATTAATAGGAAGG + Intronic
954586920 3:51744393-51744415 GAGGCTTATCATTAATAGGAAGG - Intergenic
954598861 3:51852238-51852260 GAGGCTTATCATTAATAGGAAGG - Intergenic
955822181 3:62907892-62907914 GTGGCTCATCACATCTTGGAAGG + Intergenic
956843026 3:73157429-73157451 GAGGCTTATCATTAATAGGAGGG + Intergenic
958549278 3:95593411-95593433 GAGGATTATCATTAATAGGAAGG + Intergenic
958575874 3:95949506-95949528 GAGGCTTATCATTAATAGGAAGG + Intergenic
959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG + Intergenic
960063623 3:113348599-113348621 GAGGCTTATCATTAATAGGAAGG - Intronic
961261597 3:125606438-125606460 GAGGCTTATCATTAATAGGAAGG - Intergenic
961555066 3:127691642-127691664 GTGGCTGCTCATTTTGAGGAAGG + Exonic
963021189 3:140874421-140874443 GAGGCTTATCATTAATAGGAAGG - Intergenic
963409277 3:144907781-144907803 GAGGTTTATCATTAATAGGAAGG + Intergenic
963696680 3:148572906-148572928 GAGGCTTATCATTAATAGGAAGG - Intergenic
963992355 3:151668897-151668919 GAGGCTTATCATTAATAGGAAGG + Intergenic
964064429 3:152561893-152561915 GAGGATTATCATTAATAGGAAGG - Intergenic
964848042 3:161064973-161064995 TGGGCTCCTCATTTCTAGGAGGG - Intronic
965062679 3:163803659-163803681 GAGGCTTATCATTAATCGGAAGG - Intergenic
967583550 3:191187515-191187537 GAGGCTCATCATTAATAGGAAGG - Intergenic
968028163 3:195460533-195460555 GGAGCTTATCTTTTCTAGTAAGG - Intergenic
968028169 3:195460564-195460586 GGAGCTTATCTTTTCTAGTAAGG - Intergenic
968826074 4:2898244-2898266 GTGGCTTATCATGACTACCATGG + Exonic
969366678 4:6699239-6699261 GTGGTTTGTCATTTATAGGACGG - Intergenic
971281277 4:25244296-25244318 GAGGATTATCATTAATAGGAAGG + Intronic
971578403 4:28305093-28305115 GAGGCTTATCATTAATAGGAAGG - Intergenic
972133376 4:35863116-35863138 GAGGCTTATCATTATTAGGAAGG + Intergenic
972284549 4:37635641-37635663 GTGATTTATCACTTCTAGAATGG + Intronic
974174424 4:58306435-58306457 GAGGATTATCATTAATAGGAAGG - Intergenic
974187246 4:58460172-58460194 GAGGATTATCATTAATAGGAAGG - Intergenic
974526484 4:63054928-63054950 GAGGCTTATCATTAATAGGAAGG - Intergenic
974547113 4:63326628-63326650 GTTATTTATCATTTCTAGAAAGG + Intergenic
974838917 4:67280219-67280241 GAGGATTATCATTAATAGGAAGG + Intergenic
974936984 4:68420434-68420456 ATGGCTTCTCTTTGCTAGGAAGG - Intergenic
975047925 4:69826918-69826940 GAGGCTTATCATTAATAGGAAGG - Intronic
976167092 4:82267607-82267629 GTGGCTTTTCATTCCCAGGGAGG - Intergenic
976231756 4:82851725-82851747 GTGGCTGTACTTTTCTAGGAGGG - Intronic
977884025 4:102237391-102237413 GAGGATTATCATTAATAGGAAGG - Intergenic
978975621 4:114866808-114866830 GTGGCTTATAAGTTCCATGAAGG + Intronic
980290968 4:130847132-130847154 GAGGCTTATCATTAATAGGTAGG + Intergenic
982877227 4:160664433-160664455 GAGGCTTATCATTAATAGGAAGG - Intergenic
983834998 4:172375089-172375111 GAGGATTATCATTAATAGGAAGG + Intronic
984917375 4:184736518-184736540 GAGGATTATCATTAATAGGAAGG - Intergenic
987929822 5:24389263-24389285 GAGGCTTATCATTAATAGGAAGG - Intergenic
988357738 5:30199708-30199730 GAGGCTTATCATTAATAGGAAGG - Intergenic
988929765 5:36026378-36026400 GTGACTTTTCCTTTCTAGGTAGG - Intergenic
989496170 5:42113397-42113419 GAGGCTTATCATTAATAGGAAGG - Intergenic
989957274 5:50372422-50372444 GAGGATTATCATTAATAGGAAGG - Intergenic
989964435 5:50451500-50451522 GAGGCTTATCATTAATAGGAAGG + Intergenic
990035628 5:51315187-51315209 ATTGCTTATTAGTTCTAGGAGGG + Intergenic
990116663 5:52399386-52399408 GAGGCTTATCATTAATAGGAAGG - Intergenic
990367946 5:55089094-55089116 GAGGCTTATCATTAATAGGAAGG + Intergenic
991504312 5:67308246-67308268 GTGCCTCAGCTTTTCTAGGATGG + Intergenic
991619217 5:68528030-68528052 ATTGCTTATTAGTTCTAGGAGGG + Intergenic
992455125 5:76909581-76909603 GAGGCTTATCATTAATAGGAAGG - Intronic
992545698 5:77812095-77812117 GAGGCTTATCATTAATAGGAAGG - Intronic
993367594 5:87052031-87052053 TTTGCTTATCAGTTCTAAGAGGG - Intergenic
995706362 5:114992469-114992491 GAGGATTATCATTAATAGGAAGG - Intergenic
996099307 5:119430759-119430781 GAGGCTTATCATTAATAGGAAGG + Intergenic
996386625 5:122915694-122915716 GTGGCTTCTCCTTTCTTGTAAGG + Intronic
996680304 5:126223384-126223406 GAGGCTTATCATTAATAGGAAGG - Intergenic
997072323 5:130635682-130635704 GAGGCTTATCATTAATGGGAAGG - Intergenic
997427842 5:133816443-133816465 TGGGCTTTTCATCTCTAGGAGGG - Intergenic
998111386 5:139505420-139505442 GAGGCTTATCATTAATAGGAAGG - Intergenic
998914988 5:147003231-147003253 GAGGCTTATCATTAATAGGAAGG - Intronic
1000085153 5:157882104-157882126 GAGGATTATCATTAATAGGAAGG - Intergenic
1000876958 5:166651895-166651917 GTAGGTAATTATTTCTAGGAAGG + Intergenic
1003805713 6:9724382-9724404 GAGGCTTACCATTAATAGGAAGG - Intronic
1003977052 6:11354356-11354378 AGGGCTTATCATTTTTCGGATGG + Intronic
1004531286 6:16457776-16457798 GAGGCTCATCATTAATAGGAAGG - Intronic
1004812161 6:19273301-19273323 GAGGATTATCATTAATAGGAAGG - Intergenic
1008073841 6:47125431-47125453 ATTGCTTATCAATTCCAGGAAGG + Intergenic
1009386020 6:63084711-63084733 GAGCCTTATCATTAATAGGAAGG + Intergenic
1009407788 6:63331142-63331164 GAGGATTATCATTAATAGGAAGG + Intergenic
1009470723 6:64026709-64026731 GAGGATTATCATTAATAGGAAGG - Intronic
1010269752 6:73905964-73905986 GAGGTTTATCATTAATAGGAAGG - Intergenic
1011375127 6:86679301-86679323 GAGGCTTATCATTAATAGGAAGG + Intergenic
1012441637 6:99266725-99266747 GAGGCTTATCATTAATAGGAAGG + Intergenic
1012939326 6:105400891-105400913 GTAGCCTTTGATTTCTAGGATGG - Intronic
1013185529 6:107754462-107754484 GTGGGATATCATTCCTAGAAAGG - Intronic
1013977339 6:116093179-116093201 GAGGCTTATCATTAATAGGAAGG - Intergenic
1014072593 6:117200435-117200457 TTGGACTATCATTTCTAGAATGG + Intergenic
1015768233 6:136741764-136741786 ATTGCTTATTAATTCTAGGAGGG - Intronic
1016183946 6:141178248-141178270 GAGGATTATCATTAATAGGAAGG - Intergenic
1016640115 6:146338580-146338602 GTGGACTATCATTTCTTTGAAGG - Intronic
1017688992 6:156944649-156944671 GTTGCTTTTCATTTCTTGGTGGG + Intronic
1018455208 6:163945614-163945636 GTGGGTTTTTATTTCTAGGCTGG + Intergenic
1021217648 7:17937322-17937344 GTGGCTTCTCATTTCTGAAAAGG + Intronic
1021356658 7:19658957-19658979 GAGACTTATCATTAATAGGAAGG + Intergenic
1021756806 7:23859994-23860016 GAGGCTTATCATTAATAGGAAGG + Intergenic
1023078039 7:36502676-36502698 TAGGCTTATCATTAATAGGAAGG + Intergenic
1024139277 7:46445575-46445597 AAGGCTTATCATTTGAAGGAGGG - Intergenic
1024870870 7:53960604-53960626 GAGGATTATCATTAATAGGAAGG + Intergenic
1028120797 7:87054684-87054706 GTAGCTTACCAAATCTAGGAAGG + Intronic
1028495306 7:91454239-91454261 GAGGCTTATCATTAATAGGAAGG + Intergenic
1030420435 7:109301287-109301309 GAGGCTTATCAGTAATAGGAAGG - Intergenic
1031731695 7:125309910-125309932 GAGGCTTATCATTAAGAGGAAGG - Intergenic
1033546133 7:142401872-142401894 GTGGCTCATCGTTCCTAGGCTGG - Intergenic
1033759335 7:144422836-144422858 GAGGATTATCATTAGTAGGAAGG + Intergenic
1034580060 7:152034195-152034217 GAGGCTTATCATTAATAGGAAGG + Intronic
1035992976 8:4512554-4512576 ATTGCTTATTAGTTCTAGGAAGG - Intronic
1035993633 8:4520641-4520663 ATGGCGTATCATTGCTAGTAGGG - Intronic
1036673696 8:10811546-10811568 GTGGGTTAGCAATTCGAGGAAGG + Intronic
1038638699 8:29307065-29307087 GAGGCTTATCATTAATAGGAAGG - Intergenic
1039275914 8:35934093-35934115 GAGGCTCATCATTAGTAGGATGG - Intergenic
1039693264 8:39883409-39883431 GAGGCTTATCATTAACAGGAAGG + Intergenic
1040527123 8:48235129-48235151 GAGGCTTATCATTAATAGGAAGG - Intergenic
1040796890 8:51297190-51297212 GAGGCTCATCATTAATAGGAAGG + Intergenic
1040965144 8:53075010-53075032 GAGGATTATCATTAATAGGAAGG + Intergenic
1040971551 8:53141468-53141490 GAGGCTTATCATTAATAGGAAGG + Intergenic
1041185161 8:55291723-55291745 TTGGCTTACTAGTTCTAGGAGGG + Intronic
1042771817 8:72390038-72390060 GAGGCTTATCATTAATAGGAAGG - Intergenic
1042899891 8:73714627-73714649 GTTCCTTTTCATATCTAGGAAGG - Intronic
1042919523 8:73908100-73908122 GAGGCTGATCATTAATAGGAAGG - Intergenic
1043256974 8:78149699-78149721 GAGGCTTATCATTAATAGGAAGG - Intergenic
1043820473 8:84857089-84857111 GTGCCTATTCATTTCTAAGAAGG - Intronic
1043957725 8:86381496-86381518 GTGGCGTAACATTTCTGGAAGGG - Exonic
1045858456 8:106790644-106790666 GAGGCTTGTCATTAATAGGAAGG - Intergenic
1045921647 8:107537143-107537165 GTTTCTTATCATCTCTAAGATGG + Intergenic
1046988572 8:120421175-120421197 GTAACTTATTATTTATAGGAAGG + Intronic
1051854323 9:21545817-21545839 GTGGGTTATAATTTCCAGCAAGG - Intergenic
1051935182 9:22436627-22436649 GAGGCTTATGATTAATAGGAAGG - Intergenic
1052057860 9:23923786-23923808 GAGGCTTATCATTACTAGGAAGG + Intergenic
1055458375 9:76493659-76493681 GAGGCTCATCATTAATAGGAAGG + Intronic
1056392876 9:86155189-86155211 GAGGCTTATCAATAATAGGAAGG + Intergenic
1059680266 9:116579142-116579164 GTGTCTCAACATTTGTAGGAGGG + Intronic
1061687181 9:132290966-132290988 GGGGCTTAACATTTAAAGGATGG - Intronic
1188136427 X:26499554-26499576 GAGGCTTATTATTAATAGGAAGG - Intergenic
1190421699 X:50291157-50291179 CTGCCTTATCATTTCTAGCATGG + Intronic
1191206030 X:57834919-57834941 AAGGCTTATCATTAATAGGAAGG + Intergenic
1192482860 X:71500108-71500130 GAGGCTTATCATTAATAGGAAGG + Intronic
1195001377 X:100646421-100646443 GTTGCCTATTATTTCCAGGAAGG + Intronic
1195439476 X:104884838-104884860 GAGGCTTATCATTAATAGGAAGG - Intronic
1195552482 X:106184931-106184953 GAGGCTTATCATTAATAGGAAGG + Intronic
1195982177 X:110590941-110590963 CTGGTTTCTCATTGCTAGGATGG + Intergenic
1196419481 X:115507541-115507563 GAGACTTATCATTAATAGGAAGG + Intergenic
1196488891 X:116245586-116245608 GAGGCTTAACATTAATAGGAAGG - Intergenic
1197513310 X:127397097-127397119 GAGGCTTATCATTAATAGGAAGG - Intergenic
1197887558 X:131234497-131234519 ATGGTTCATCATTTCTTGGAAGG + Intergenic
1198562110 X:137861681-137861703 ATGGCCTATCATCTCTACGAAGG - Intergenic
1199832504 X:151560130-151560152 GAGGCTTATCATTAATAGGAAGG + Intergenic
1200695058 Y:6351353-6351375 GTGGCTTATCAGTAATAGAAAGG + Intergenic
1200959228 Y:8981953-8981975 GAAGCTTATCATTAATAGGAAGG - Intergenic
1201040219 Y:9823357-9823379 GTGGCTTATCAGTAATAGAAAGG - Intergenic
1201272009 Y:12264615-12264637 GAGGCTTATCATCAATAGGAAGG + Intergenic
1201312140 Y:12606630-12606652 GAGGCTTATTATTAATAGGAAGG + Intergenic
1201403956 Y:13631856-13631878 GAGGCTTATCACTAATAGGAAGG - Intergenic
1201429604 Y:13891034-13891056 GAGGATTATCATTCATAGGAAGG - Intergenic
1201530468 Y:14985547-14985569 GAGGCTTATCATTAATAGGAAGG - Intergenic
1201729674 Y:17190561-17190583 GAGGCTGATCATTAATAGGAAGG + Intergenic
1201911015 Y:19133611-19133633 GAGGCTTATCTTTAATAGGAAGG - Intergenic
1201989607 Y:20009402-20009424 GAGGCTTATCATTAATAGGAAGG + Intergenic
1202089954 Y:21178934-21178956 GGGGATTATCATTAATAGGAAGG + Intergenic
1202192701 Y:22260774-22260796 GAGGCTTATCATTAATAGAAGGG + Intergenic
1202242794 Y:22788238-22788260 GAGGCTTATCATTAATAAGAAGG - Intergenic
1202257736 Y:22939093-22939115 GAGGCTTATCATTAATAGGAAGG - Intergenic
1202272152 Y:23082844-23082866 GAGGATTATCATTCATAGGAAGG + Intergenic
1202293874 Y:23337838-23337860 GAGGATTATCATTCATAGGAAGG - Intergenic
1202395781 Y:24421988-24422010 GAGGCTTATCATTAATAAGAAGG - Intergenic
1202410726 Y:24572840-24572862 GAGGCTTATCATTAATAGGAAGG - Intergenic
1202425149 Y:24716588-24716610 GAGGATTATCATTCATAGGAAGG + Intergenic
1202445640 Y:24953497-24953519 GAGGATTATCATTCATAGGAAGG - Intergenic
1202460055 Y:25097232-25097254 GAGGCTTATCATTAATAGGAAGG + Intergenic
1202475004 Y:25248104-25248126 GAGGCTTATCATTAATAAGAAGG + Intergenic