ID: 1083102732

View in Genome Browser
Species Human (GRCh38)
Location 11:60326769-60326791
Sequence AATTCTGTGCAGAAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083102732_1083102738 22 Left 1083102732 11:60326769-60326791 CCTGCCTTCTTCTGCACAGAATT No data
Right 1083102738 11:60326814-60326836 ATGCTACTAAAAGCAGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083102732 Original CRISPR AATTCTGTGCAGAAGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr