ID: 1083104085

View in Genome Browser
Species Human (GRCh38)
Location 11:60340823-60340845
Sequence ATTGACTTCTTGGGAAAAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083104081_1083104085 14 Left 1083104081 11:60340786-60340808 CCTCAAAGACGACTCATGATGCT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG 0: 1
1: 0
2: 5
3: 39
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083104085 Original CRISPR ATTGACTTCTTGGGAAAAAA CGG Exonic
903092468 1:20933696-20933718 AATGACTGGATGGGAAAAAAGGG + Intronic
903397862 1:23016023-23016045 AGTTATTTCTGGGGAAAAAACGG + Intergenic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
905565496 1:38961177-38961199 ACTGACTTCTGGGGAAGGAAGGG + Intergenic
905628650 1:39506112-39506134 ATTGAATTCTTGACAGAAAAAGG + Intronic
906014250 1:42560034-42560056 AATGACTTCTTGGTAAATAATGG + Intronic
906623041 1:47300439-47300461 ATTTACCACATGGGAAAAAATGG + Intronic
906627280 1:47335012-47335034 ATTGACACTGTGGGAAAAAAAGG + Intronic
906935257 1:50208998-50209020 TTTGAATCCTTGGGAGAAAAAGG + Intergenic
906987705 1:50703581-50703603 ATTAACTTAAAGGGAAAAAAAGG + Intronic
907116175 1:51970436-51970458 ATTAACTTCTCAGGAAACAAAGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907738343 1:57138629-57138651 AGTGAATTCATGGGAAAACAAGG - Intronic
907914394 1:58855344-58855366 TTTGAAATCTTGGGAAAAAGAGG - Intergenic
908249084 1:62251093-62251115 ATTGTCTTCTTTGGAGAAAAGGG + Intronic
908406019 1:63815047-63815069 TTTGATCTCTTTGGAAAAAAGGG + Intronic
908895151 1:68889970-68889992 ATTTACTTCTAGGGAGAAAAAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
909294174 1:73924866-73924888 AATCACTTCTTTAGAAAAAAAGG + Intergenic
909517251 1:76525478-76525500 ATTCACTTCTTAGGGAAGAAAGG - Intronic
910462254 1:87460157-87460179 ATTGCTTTCTTTGGACAAAAAGG + Intergenic
910919131 1:92324845-92324867 AGAGACTTATTGGGAAATAATGG + Intronic
911456570 1:98131581-98131603 ATTGACATCTGGAGAAAAATTGG + Intergenic
911733223 1:101311070-101311092 ATTGACTTCTTGGCATGAAGTGG - Intergenic
912999374 1:114564352-114564374 AGTGATTTCTTGGAAACAAAGGG + Intergenic
914587082 1:149072565-149072587 AAGGACTTCTTGGGTAAGAACGG - Intronic
915989035 1:160494526-160494548 ATTACCTTATTGGAAAAAAAGGG + Intronic
916004176 1:160644782-160644804 ATTGACATCTTGGGATAGAATGG + Intronic
916410498 1:164542467-164542489 ATTGACAACTTGCGAAAACAGGG + Intergenic
916471258 1:165125133-165125155 CTTGACTTCTGGGGAAGAAAGGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917957240 1:180112039-180112061 TCTGACTTCTTGGGGAAAGATGG - Exonic
918555557 1:185795384-185795406 ATGCAGCTCTTGGGAAAAAAAGG - Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
922396517 1:225207184-225207206 TTTGACTTCATGGGTAAAAATGG + Intronic
922694879 1:227724917-227724939 TTTACCTTCTTGGGGAAAAAAGG - Intergenic
923433217 1:233943932-233943954 AATGACTTTTGGGGAAAAAATGG + Intronic
923507180 1:234614435-234614457 ATTGACTTTTTGGAAAAAGCAGG + Intergenic
923637933 1:235719827-235719849 ATTGACTTGTTGGAAAAACCAGG - Intronic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
924593850 1:245428216-245428238 GTTGATTTCTTGGAAAAGAAGGG + Intronic
924793466 1:247274438-247274460 ATTGGTTTTTTGAGAAAAAAAGG - Intergenic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1062955187 10:1535577-1535599 ATTGCCGTCTGGGGAAAAATGGG - Intronic
1063307199 10:4915419-4915441 ATTGCACTCCTGGGAAAAAAGGG - Intergenic
1064380407 10:14837317-14837339 ACTGACTCCTTGGGAAAGAGAGG - Intronic
1064847738 10:19674418-19674440 TTTGACCTCTTGGGAAAACAAGG - Intronic
1066020271 10:31291924-31291946 ATTAACTACTAAGGAAAAAATGG + Intergenic
1066319971 10:34292683-34292705 CTTGGCATCTTGGGAAAAAGAGG + Intronic
1066800770 10:39186999-39187021 ATTGACGTCTATGGTAAAAAAGG - Intergenic
1067565523 10:47333514-47333536 AGTGACTTCTGGAGAAAAATTGG - Intergenic
1068573474 10:58657197-58657219 AAAGACTTCATGGAAAAAAATGG - Intronic
1068655447 10:59570494-59570516 ATTGACATCTTGTGAAACACTGG + Intergenic
1068661015 10:59623469-59623491 AGTGACTACTGGGGAGAAAATGG - Intergenic
1068893359 10:62171697-62171719 ATTATCTTCTTGACAAAAAAAGG + Intergenic
1069085090 10:64129796-64129818 AATTACGTCTTGGGAAAAAGGGG + Intergenic
1069983119 10:72266086-72266108 AATGACTTCTTGGGAAACCTAGG + Intergenic
1071600598 10:86957026-86957048 ATTGATTTCTTTGGAAGAACAGG + Intronic
1072718470 10:97766849-97766871 AATAACTTATTGGGATAAAAGGG + Exonic
1073217884 10:101846632-101846654 ATTGACTTCTCTGGGAAAACTGG - Exonic
1073407735 10:103312562-103312584 ATATAATTCTTGGGGAAAAAAGG - Intronic
1074150744 10:110757697-110757719 ATTGACTGTTGGGGAATAAAAGG + Intronic
1075284826 10:121174450-121174472 AGTGAGTTCTTTTGAAAAAATGG + Intergenic
1075879176 10:125835250-125835272 ATTTACTTCCTGGAAAAGAAGGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078723464 11:13905548-13905570 ATTCACTACATGTGAAAAAAAGG + Intergenic
1079798340 11:24835703-24835725 ATTGTATTCTTGGCACAAAAGGG + Intronic
1080368497 11:31607939-31607961 ATTGACTTACTGCAAAAAAAAGG - Intronic
1082095335 11:48125124-48125146 ATTCGCTGCTTGGGAATAAACGG - Exonic
1083048068 11:59754470-59754492 TTTGTCTTCTTGGGAACAAATGG - Intronic
1083088200 11:60172148-60172170 ATTGACTTCTTAAGAAAAAAGGG - Intronic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1084543160 11:69799831-69799853 TTTGACTTCATGGTACAAAATGG - Intergenic
1085131938 11:74047571-74047593 AGTGTCTTCTTGGAATAAAAGGG + Intronic
1085860856 11:80233629-80233651 AATGACTTCTGGGTAAATAATGG + Intergenic
1086571794 11:88293804-88293826 ATTGAATACTTAGAAAAAAATGG + Exonic
1086668031 11:89509313-89509335 ATTGACTTCATTGGAACAAAAGG + Intergenic
1087692157 11:101333471-101333493 ATTAACTTATTGAGAAATAATGG + Intergenic
1088941818 11:114467369-114467391 CTTTACTTTTTGGGAAGAAAAGG + Intergenic
1090449228 11:126791511-126791533 ATTCATTTCTTTGGAAAGAAGGG - Intronic
1091252036 11:134152222-134152244 CATCCCTTCTTGGGAAAAAATGG - Intronic
1091869843 12:3880155-3880177 ATTCACATCTTGGGGAAAACGGG + Intergenic
1092801976 12:12177362-12177384 ATACACTTCTTGGAAAAAGAGGG + Intronic
1094228094 12:28069458-28069480 ATTCTCTTCTAGGCAAAAAATGG - Intergenic
1094876556 12:34651994-34652016 ATTGAATCCTTGGGTGAAAAAGG + Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1095378876 12:41565153-41565175 ATTGACTCTTTTGGAGAAAAAGG - Intronic
1095757026 12:45780305-45780327 AATGACTTCATGGGAATAAATGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097626246 12:62003899-62003921 ATGCACTTCTTGTGAAAAATGGG - Intronic
1097817807 12:64095052-64095074 ATTTACTTCCTGGGAAAAGAGGG + Intronic
1099369220 12:81810029-81810051 TATTACTTCTAGGGAAAAAAAGG + Intergenic
1100338578 12:93656302-93656324 ATTGTCTTCTGGGCAAAAGAAGG + Intergenic
1100460212 12:94792296-94792318 ATTGACTTCTTGTGAAAATAAGG - Intergenic
1100688612 12:97013938-97013960 CTTGATTTCTTTGAAAAAAAAGG + Intergenic
1100699216 12:97128550-97128572 ACTGACTTCAAGGGAAAAGAAGG + Intergenic
1100781260 12:98029158-98029180 ATTCACTTTCTGGGAAAAAAAGG + Intergenic
1102844432 12:116163977-116163999 ATGTTCTTCTTGGGAGAAAAAGG + Intronic
1103441480 12:120966100-120966122 ATTGGCTTCTTTGGGAAAAGTGG - Intergenic
1105893703 13:24700311-24700333 GATGATTTCTAGGGAAAAAAGGG - Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108270924 13:48758806-48758828 ATGACCTTCTTTGGAAAAAAGGG + Intergenic
1109061361 13:57624976-57624998 ATTTACTTCTTAGGAAAATTAGG - Intergenic
1109368102 13:61384137-61384159 ATTGAGTTATTGGGACAAACTGG + Intergenic
1110261881 13:73494077-73494099 ATTGACTACTTGGTGAAAATTGG - Intergenic
1110355211 13:74559545-74559567 TTTGACCTTTTGGGAAAATAGGG + Intergenic
1110591150 13:77260939-77260961 AATTACAACTTGGGAAAAAAAGG - Intronic
1110913651 13:80994849-80994871 ATTTACTTCTTCAAAAAAAAAGG + Intergenic
1110945126 13:81404301-81404323 ATAGTGTTCTTAGGAAAAAATGG + Intergenic
1111249358 13:85583358-85583380 ATTGTGTTTTTGGAAAAAAAAGG + Intergenic
1111445081 13:88336649-88336671 CTTGACTTTTTGTGAAAATAAGG - Intergenic
1111959939 13:94799095-94799117 CTTTGCTTCATGGGAAAAAATGG - Intergenic
1112172900 13:96992858-96992880 ATTGGCATCTTGGGAAAAGGAGG - Intronic
1112421477 13:99254113-99254135 ATTAACTTCTTTTGTAAAAATGG + Intronic
1114228347 14:20758716-20758738 ATTGATTTATTGGTCAAAAAGGG + Intergenic
1114895026 14:26977814-26977836 ATTGACTTTTTAGTTAAAAATGG - Intergenic
1118431558 14:65723863-65723885 ATTCACATCTTAGGAATAAATGG - Intronic
1119177851 14:72582419-72582441 ATTAAATTCATGGAAAAAAATGG + Intergenic
1119756267 14:77122070-77122092 ATTTAATTCAAGGGAAAAAAAGG + Intronic
1119922089 14:78455796-78455818 ATTGAGTTCTGGGCAAAAGAGGG - Intronic
1120265922 14:82251196-82251218 AATGACTTCTTAAGGAAAAATGG - Intergenic
1120428080 14:84376353-84376375 TTTGACCTCTTGGAAAAAAAAGG + Intergenic
1120452685 14:84689003-84689025 ATAGATTTCTTGCTAAAAAAAGG - Intergenic
1122839520 14:104449917-104449939 ATTGTCTTATTGGGACAAAAAGG + Intergenic
1124949269 15:34301510-34301532 CTAGACTTGTTGGGAAAAATTGG - Intronic
1127231512 15:57000928-57000950 ATTTATTTCTAGGAAAAAAATGG - Intronic
1128180903 15:65602907-65602929 ATTTTCTTCTTTTGAAAAAAAGG - Intronic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1130090281 15:80815074-80815096 ATTCACTTCTTTGGAAAAACCGG + Intronic
1130792558 15:87170985-87171007 ATAAACTTCTATGGAAAAAATGG + Intergenic
1131436411 15:92426226-92426248 ATTGAGTGCTTTGGGAAAAAAGG + Intronic
1131593648 15:93774642-93774664 AGAGACTTCTTGGGAGACAATGG - Intergenic
1134206471 16:12242243-12242265 TTTGACTTCTTGGGAGGAGAAGG + Intronic
1135434719 16:22418976-22418998 ATTGACTTCCTTGGAAACAGAGG + Intronic
1135458107 16:22616560-22616582 ATAGAGTGCTTGGGAAAAGACGG - Intergenic
1137780755 16:51095929-51095951 ATTTACTCCCAGGGAAAAAAGGG + Intergenic
1137801434 16:51265749-51265771 ATTACCTTATTTGGAAAAAAGGG - Intergenic
1137821247 16:51448237-51448259 AATCACTTCTTGGGAATTAATGG + Intergenic
1138015563 16:53425316-53425338 ATTGATTTATAGGTAAAAAAAGG + Intergenic
1139001489 16:62515913-62515935 ATTGAATAGATGGGAAAAAAGGG + Intergenic
1139282573 16:65783364-65783386 TTTGATTTCTTGGGAGAAAAAGG + Intergenic
1139822915 16:69734887-69734909 ATTGCCATATTGGGAAGAAAAGG - Intergenic
1140776034 16:78249742-78249764 TTTCAATTCTTGGGAAGAAAGGG - Intronic
1141690548 16:85594071-85594093 TTTGACTTCTTTGCAGAAAAGGG + Intergenic
1141738218 16:85870063-85870085 ATCTATTTCTTGGGAAAAACAGG - Intergenic
1142775333 17:2133361-2133383 GTTTAATTCTTTGGAAAAAATGG + Intronic
1143246877 17:5494095-5494117 ATTGACTTCTTTGTAGAAATTGG + Intergenic
1144044121 17:11439486-11439508 TTAGACTTCTGGGGGAAAAATGG + Intronic
1144116063 17:12092142-12092164 ATTTACTGCCAGGGAAAAAAAGG + Intronic
1144254237 17:13450159-13450181 TTTGCCTTCAAGGGAAAAAATGG - Intergenic
1146682223 17:34816411-34816433 ACTGAGTTCTTGGGAACAAACGG + Intergenic
1147801452 17:43092565-43092587 AATGACTTGATGGGAAAAAGTGG + Exonic
1149142672 17:53452900-53452922 ATCGACTCCCTGGGAAAATAAGG + Intergenic
1149207987 17:54270617-54270639 GCTGACTTCTTGGGTAAAATTGG - Intergenic
1150089069 17:62304979-62305001 AATAACTTATGGGGAAAAAAAGG - Intergenic
1150147418 17:62780694-62780716 ATTTACTTCATGGGGAAGAAAGG - Intronic
1150589339 17:66548620-66548642 ATTGCCTTATTTGGAAAAAAAGG + Intronic
1153481598 18:5552770-5552792 ATTGACCTCTTTTGAAAATAAGG - Intronic
1153513162 18:5877602-5877624 ATTGTCATCTTGGCAAAGAAAGG + Intergenic
1156323013 18:36045867-36045889 ATAAACTGCATGGGAAAAAAGGG + Intronic
1156675697 18:39524896-39524918 TTTCACTTCATGGGAGAAAAGGG + Intergenic
1156704652 18:39865066-39865088 ATTGACTTCATTGAAAAATAGGG + Intergenic
1156782986 18:40874729-40874751 AATAAATTCTGGGGAAAAAAAGG + Intergenic
1156831646 18:41499103-41499125 ATTGACTACTCAGGAACAAATGG - Intergenic
1157785789 18:50481446-50481468 ATTGAGTGATTGGGAATAAAGGG + Intergenic
1157852555 18:51069836-51069858 TTTGACTTCTTGGAATAATATGG - Intronic
1158636197 18:59160468-59160490 ATTGTTTTCTTAAGAAAAAATGG + Intergenic
1159306613 18:66651656-66651678 ATGGACTACATGGGAAAACATGG - Intergenic
1159864553 18:73688747-73688769 GTTGTCTGCTTGGGAACAAAGGG + Intergenic
1161053901 19:2180354-2180376 ACTGACCTCCAGGGAAAAAATGG + Intronic
1166717909 19:44980541-44980563 ATTGGCCTCTTGGGGATAAAAGG - Intronic
1168010058 19:53522754-53522776 AATGACTATTTGGGAAGAAATGG - Intronic
926407138 2:12566843-12566865 ATTTACTTCTTAGCAAGAAAAGG - Intergenic
926764694 2:16314018-16314040 ATGACCTTCTTTGGAAAAAAAGG - Intergenic
926835406 2:17013696-17013718 AGTGACTTATTAGGAAACAATGG + Intergenic
927431590 2:23030893-23030915 ATAGTCTTCTTAGGAAAACATGG - Intergenic
927469212 2:23359748-23359770 CTTGACTTCTTGGGGAACCACGG + Intergenic
928530606 2:32187030-32187052 AATGAGTTCGGGGGAAAAAATGG + Intronic
929008344 2:37416988-37417010 ATTTTATTTTTGGGAAAAAATGG + Intergenic
929472885 2:42214056-42214078 ATTGACATGTTAGGAAAAATTGG - Intronic
929603939 2:43222404-43222426 ATAAAATTTTTGGGAAAAAAAGG - Exonic
929932869 2:46272365-46272387 ATTTATTTCTTAGGAAAAGAAGG - Intergenic
930407222 2:50974156-50974178 ATTCACATCATGAGAAAAAATGG - Intronic
931235904 2:60412523-60412545 ATAGATTTATTGGGAAAAAAAGG - Intergenic
931485240 2:62684078-62684100 ATTGTCATCTTAGGAAACAAAGG + Intronic
931874362 2:66496039-66496061 ATTCAGTTCTGGGGAAAGAAAGG + Intronic
931989024 2:67770889-67770911 AATCAGTTCTTGGGAAAAAGGGG - Intergenic
932300382 2:70662990-70663012 ATTGGATTCCTGGGAAGAAATGG + Exonic
933059539 2:77720220-77720242 TTTCAACTCTTGGGAAAAAAGGG - Intergenic
933117126 2:78488213-78488235 ATTATCTCCTAGGGAAAAAATGG - Intergenic
933231023 2:79807270-79807292 GTTGTCTTTTTGGGAAACAAGGG - Intronic
933420187 2:82035148-82035170 ATTCTTTTGTTGGGAAAAAAAGG + Intergenic
934810079 2:97270147-97270169 TTTGAATTCTTGGGATGAAATGG + Intergenic
934827613 2:97437792-97437814 TTTGAATTCTTGGGATGAAATGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934959321 2:98654946-98654968 ATTGTGTTCTTGGTAAAAATTGG + Intronic
935516652 2:104048727-104048749 ATCGACTTGCTGGAAAAAAAGGG + Intergenic
935787555 2:106562771-106562793 TTTGACTTATTTGGAAAAGAAGG + Intergenic
937025994 2:118697680-118697702 ATTCTATTTTTGGGAAAAAATGG - Intergenic
937549386 2:123068225-123068247 ATTGACTCCTTGTGAAAATTGGG - Intergenic
938613213 2:132970723-132970745 GTTGACTGCTTGAGAACAAAAGG - Intronic
938706723 2:133937373-133937395 AATGACTTAATGTGAAAAAAAGG - Intergenic
938792212 2:134686566-134686588 ATTGACTTATGGGGCCAAAAAGG + Intronic
939011281 2:136848658-136848680 ATTTACTTCTAGGCAAAAATTGG - Intronic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
939769079 2:146292106-146292128 TTTCACTTCTAGTGAAAAAATGG + Intergenic
939956652 2:148533004-148533026 AGTGAAATCTTGGGAGAAAAAGG - Intergenic
940135000 2:150425646-150425668 ATTGTCTTCTTACTAAAAAAAGG - Intergenic
940321051 2:152376801-152376823 ATTGCTTTCTTGGGAATTAAGGG + Intronic
940458755 2:153935848-153935870 ACTGACATCTGGGGAAGAAATGG - Intronic
941220460 2:162772978-162773000 ATTGGGTACTTGGGAAAAGATGG - Intronic
941249058 2:163139009-163139031 ATTGACTGCTTGGGATAAGGGGG + Intergenic
941347976 2:164393410-164393432 ATTAAATTCTTGGGTCAAAATGG - Intergenic
941401357 2:165034801-165034823 ATGGTCTTCATGGGAAGAAATGG + Intergenic
941598530 2:167508995-167509017 CTTGACTCTTTGGGAACAAAAGG - Intergenic
941618940 2:167755438-167755460 ATAGAATTCTCGGGAAGAAATGG - Intergenic
942211573 2:173676551-173676573 ATTGACTTCTGGGGAGGAAGAGG + Intergenic
942530658 2:176906362-176906384 ATTGTTTCCCTGGGAAAAAAAGG + Intergenic
943044219 2:182839356-182839378 ATTTACTTCTTGAATAAAAATGG + Intronic
943101998 2:183498074-183498096 ATTAACATCTTGGGAAGAACAGG - Intergenic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
943794008 2:191968898-191968920 ATTGAGTTTTTGGTAAAAAGAGG + Intronic
943919693 2:193689336-193689358 ATAGACTTCCAGGGAAAAACTGG - Intergenic
944478599 2:200131790-200131812 GTTTACTTCTAGGGAAGAAAAGG + Intergenic
944489220 2:200240476-200240498 ATGGACTTCTTCTGAAGAAACGG - Intergenic
945384269 2:209178689-209178711 ATAGCCTTCATGGGAAACAATGG + Intergenic
945491103 2:210456194-210456216 ATGTACTTCAAGGGAAAAAATGG - Intronic
947537480 2:230949493-230949515 ATTGCCTTCCTGGGAAGAATGGG + Intronic
948092386 2:235305383-235305405 CTTGTCTTCTTGGGCAAAAGGGG + Intergenic
948151333 2:235747310-235747332 ATGGAATTCATGGGAATAAATGG - Intronic
948178872 2:235964668-235964690 ATAGATATCTTGGAAAAAAAAGG - Intronic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1169609150 20:7359757-7359779 TTTGACTTGTTCAGAAAAAAAGG + Intergenic
1169769348 20:9184221-9184243 ATTGTGGTCATGGGAAAAAACGG + Intronic
1170102585 20:12718817-12718839 ATAGTCTTCTTGGCAGAAAATGG + Intergenic
1170512602 20:17094265-17094287 ATTAACTTCCTTTGAAAAAAGGG - Intergenic
1176893167 21:14343850-14343872 ATTGAATATTTGAGAAAAAATGG + Intergenic
1178364066 21:31973881-31973903 ATAAACTCCTTGGGATAAAATGG - Intronic
1178441165 21:32599601-32599623 ATTGATTTCTTGGGAAATCCTGG + Intronic
1179234586 21:39534348-39534370 ATGAACTTCTTGGTAAGAAAAGG + Intergenic
1179612032 21:42558600-42558622 AATGACATCTTGTAAAAAAAAGG - Intronic
1181793654 22:25287174-25287196 ATAGACTCATTGGGAAGAAAAGG - Intergenic
1182222082 22:28766705-28766727 ATTGAATTCTGTGGAAGAAAGGG - Intergenic
1182838871 22:33368146-33368168 GTTGACTTATTGGGCAAATAAGG - Intronic
1183006864 22:34910821-34910843 ATTATCTTCTTGGAACAAAATGG - Intergenic
1183011656 22:34951722-34951744 AATGACTACTTTGGAAAATAAGG + Intergenic
1183115149 22:35686083-35686105 ATTGGGTTTTTGGGCAAAAAAGG - Intergenic
1183328256 22:37205938-37205960 ATTGACTGCCTGGGCCAAAAGGG + Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950330011 3:12148800-12148822 AAAGATTTCTTGGAAAAAAATGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950633072 3:14297120-14297142 AATGACATGTTGGGGAAAAAAGG + Intergenic
951352275 3:21620476-21620498 ATTGGCTTGTTGGTATAAAATGG - Intronic
953051019 3:39343579-39343601 ATTCACCTCTTGGTAACAAAGGG + Intergenic
956271615 3:67453760-67453782 ATTGCCTTCTTGGGAGCCAAAGG - Intronic
957150222 3:76476820-76476842 TTTATATTCTTGGGAAAAAATGG + Intronic
958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG + Intergenic
958486846 3:94723412-94723434 GTTTACTTTTTGAGAAAAAAAGG - Intergenic
960188517 3:114674016-114674038 ATTTTCTTCCTGGGAAGAAAAGG - Intronic
960781681 3:121326253-121326275 AACCACATCTTGGGAAAAAAGGG + Intronic
962054054 3:131849736-131849758 ATTTTCTTCTTGGGACCAAAGGG - Intronic
962746124 3:138398455-138398477 AATGACTCCCTGGGAAATAAAGG - Exonic
963505021 3:146173545-146173567 ATTCACTTTATGGAAAAAAAAGG - Intergenic
963863759 3:150337954-150337976 TCTGATTTTTTGGGAAAAAAAGG - Intergenic
964370673 3:155996987-155997009 ACTGGCTTCTTGGAAAAAAATGG + Intergenic
965023837 3:163271660-163271682 ATTAACTTTTGGGGAAAAAAGGG + Intergenic
965188589 3:165499603-165499625 ATGGACATCTTTGGAAAGAAGGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
967459999 3:189734599-189734621 AGTGACTATCTGGGAAAAAAGGG - Intronic
967503407 3:190225510-190225532 ATTGTCTTCTTGGGAAAGAAAGG - Intergenic
968702887 4:2065098-2065120 CTTTAATTCTTGGGACAAAACGG + Exonic
970741159 4:19239277-19239299 ATGGACATCTTGGTAAATAAAGG - Intergenic
970860888 4:20700997-20701019 ATTTACTTTCTGGTAAAAAAGGG + Intronic
970976755 4:22050546-22050568 ATTGACTTCTTAGGAAAGAATGG - Intergenic
971633045 4:29019995-29020017 ATAGTCTACTTGTGAAAAAATGG + Intergenic
971681665 4:29708259-29708281 ATAGACATCTTTGGAAATAATGG - Intergenic
971746573 4:30587832-30587854 ATTGTATTCTTTGAAAAAAAGGG + Intergenic
972003683 4:34071023-34071045 ATTTACTTCTAGGGAAATCAAGG - Intergenic
972265903 4:37459542-37459564 ACTGGCTTATTGGAAAAAAATGG - Intronic
972799205 4:42455470-42455492 ATTGAATACTTGGGAGATAAAGG - Intronic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975774890 4:77775332-77775354 AATGCCTACTGGGGAAAAAATGG + Intronic
976122000 4:81793645-81793667 ATTTATATCTTGAGAAAAAACGG - Intronic
977748112 4:100576026-100576048 ATTGTCTTCTTCACAAAAAATGG - Intronic
977789668 4:101084699-101084721 ATTCAGTTCTTTGGCAAAAAGGG + Intronic
978346329 4:107773924-107773946 ATTTATCTCTGGGGAAAAAAAGG + Intergenic
978497274 4:109373845-109373867 ACTGACTATCTGGGAAAAAATGG + Intergenic
978589922 4:110313845-110313867 AATCACTTATGGGGAAAAAAAGG + Intergenic
979869546 4:125801755-125801777 TATTACTTTTTGGGAAAAAAAGG + Intergenic
979918624 4:126471856-126471878 CTTGAGTTCTAGAGAAAAAAGGG + Intergenic
980581446 4:134759070-134759092 ATTTACCTTTTGGGGAAAAAAGG - Intergenic
980657058 4:135802782-135802804 ATTGAATTATAGGAAAAAAATGG + Intergenic
981067630 4:140501827-140501849 ATTGACTTATTTGGGAAAGAGGG - Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981531332 4:145756417-145756439 CTTGACTTCTCTGGAAAACATGG - Intronic
983197273 4:164821154-164821176 ATCAAATTTTTGGGAAAAAAAGG - Intergenic
985283938 4:188314926-188314948 ATTGATCTCTGAGGAAAAAATGG + Intergenic
986554485 5:8997842-8997864 ATTAGATGCTTGGGAAAAAATGG - Intergenic
988010680 5:25478735-25478757 ATGGAGTTCAAGGGAAAAAAAGG - Intergenic
988446398 5:31290661-31290683 GTTCTTTTCTTGGGAAAAAAAGG - Intronic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990913743 5:60880849-60880871 ATTGACGAGTTGAGAAAAAAGGG - Intronic
991954619 5:71981475-71981497 ATTGTCTTCTGGCAAAAAAAGGG - Intergenic
992020401 5:72618230-72618252 ATTTACTTCATGGAAAAACAAGG + Intergenic
993132769 5:83920205-83920227 ACTGACTTCTTTGGAAGAAGAGG + Intergenic
993926182 5:93869248-93869270 ACCCACTTCTTGGGAAGAAAGGG - Intronic
994401353 5:99284466-99284488 ATTCATTTCTTTTGAAAAAATGG + Intergenic
994728692 5:103465981-103466003 ATTGGCTTCTTTGAAAAAAATGG - Intergenic
995259746 5:110089286-110089308 ATTGACTGTTTGGGAACAAATGG - Intergenic
995540435 5:113180655-113180677 ATACTCTTCTTGGGCAAAAATGG - Intronic
998770632 5:145540662-145540684 ATTGACTTCTTAGAAAAAATGGG - Intronic
1001152390 5:169243633-169243655 ATTGACTCCAGGGGAAAAGATGG + Intronic
1001776120 5:174330303-174330325 ATTGCCTTCTTGGAAAGGAAAGG - Intergenic
1003156093 6:3596434-3596456 ATTGATTTATTGTGAATAAATGG + Intergenic
1005431629 6:25763837-25763859 ATGGACTTCTGGGGGAAAAGGGG - Intronic
1005972682 6:30773656-30773678 ATTGACTGCAAGGGAAACAAGGG + Intergenic
1007142784 6:39592647-39592669 ATTGAGTTCATGGGAGGAAAAGG - Intronic
1007175788 6:39896546-39896568 ATTGTCTTCTTGGGAAGAGCTGG + Intronic
1007441728 6:41867092-41867114 ATTCACTTCTTGTTAAAATATGG - Intronic
1008376147 6:50794496-50794518 TTTGCCTTCTTGGTAAAAATGGG + Intergenic
1008822713 6:55652749-55652771 CTTGTCTACTTGGGAAAACAAGG + Intergenic
1008823555 6:55663432-55663454 ATTGACTTTTGGGTAAATAATGG - Intergenic
1008911746 6:56741002-56741024 ATTTTCTTCTTGGGTAAAAAAGG + Intronic
1009611387 6:65946050-65946072 ATTGACCTCATGGGAAGCAACGG - Intergenic
1010409400 6:75543986-75544008 ATGGACCTCTTGGGGAGAAAGGG + Intergenic
1010713968 6:79207043-79207065 AGTTACTTCTTGGGTAAAATGGG - Intronic
1010823727 6:80447614-80447636 ATGGATTCCTTGGGACAAAAGGG - Intergenic
1011793198 6:90922221-90922243 ATTGTTTTCTTGGGAGAAATTGG - Intergenic
1012603184 6:101123692-101123714 ATAGACTTGAAGGGAAAAAATGG - Intergenic
1013127052 6:107194429-107194451 ATTGACTTTTTGAGAAGACAAGG + Intronic
1013265884 6:108498460-108498482 AATGAATGCTTGGGAACAAAAGG + Intronic
1014716016 6:124865170-124865192 ATTCACTTTTGGGGAGAAAATGG + Intergenic
1015251487 6:131132501-131132523 ATTGTCCTCTGGGGAGAAAAGGG - Intergenic
1015306007 6:131709058-131709080 AATGACTTCTTTGGATAAAATGG - Exonic
1015575215 6:134664069-134664091 ATTGTCTTCTTGGGAACTACTGG - Intergenic
1015880228 6:137864872-137864894 AATGCCTTCTTATGAAAAAAAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017262115 6:152399395-152399417 CTTGCTTTCTTGGGAAAAAGAGG + Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018320133 6:162599683-162599705 ATTGACATCTTCGGGAAGAATGG - Intronic
1018765613 6:166930998-166931020 CCTGTCTTCTTGAGAAAAAAAGG + Intronic
1018946754 6:168352696-168352718 TATGTCTTCTTGGGAGAAAATGG - Intergenic
1018957323 6:168418886-168418908 ATGGCTTTCTGGGGAAAAAAAGG + Intergenic
1019156589 6:170043358-170043380 ATTTTCTTCTTGGGAAGAAATGG - Intergenic
1020815684 7:12902699-12902721 ATTTACTTCAGGGGAAGAAATGG - Intergenic
1021179350 7:17487928-17487950 AATGACTTCTGGGGGCAAAATGG - Intergenic
1021318362 7:19180040-19180062 TTTTACTTATTGGAAAAAAAGGG - Intergenic
1021359649 7:19695241-19695263 ATCTACTTTTTGAGAAAAAAAGG + Intergenic
1021460591 7:20882575-20882597 ATAGACTTTCTGGGAAAATATGG + Intergenic
1022161711 7:27717570-27717592 ATTGACTTATTGATAAAGAAGGG - Intergenic
1023115610 7:36859040-36859062 ATTTATTTATTGGGAAAAACAGG - Intronic
1023237851 7:38109377-38109399 ATTGATTTCTGGGGTACAAATGG - Intergenic
1023411793 7:39895135-39895157 TTTGACTTCCAGGGAAAGAATGG - Intergenic
1024295285 7:47836844-47836866 GTTGATTTCTTAGGCAAAAAGGG + Intronic
1025579850 7:62698591-62698613 ATTGAGTTCTAAGGAGAAAAAGG - Intergenic
1025615860 7:63115735-63115757 ATAGACTTCTTAGGTAATAATGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027508605 7:79050717-79050739 ATTGTCTTGTGGGGTAAAAATGG - Intronic
1027810932 7:82896804-82896826 ATTGTCTTCTTAGGAAATAGTGG - Intronic
1028510013 7:91614175-91614197 TTTGCCTTCTTTGGGAAAAAAGG - Intergenic
1030361756 7:108602616-108602638 TTTGACTTCTAGGGCACAAATGG + Intergenic
1031142277 7:117956517-117956539 GTGGACTTATTTGGAAAAAATGG - Intergenic
1031208708 7:118794445-118794467 AGTCATTTCTTGGGAAAGAAGGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032823255 7:135544246-135544268 TTTGTTTTCTTGGGAAAAAAGGG + Intergenic
1033678970 7:143573755-143573777 AATGACTTCTTTGGATAAAATGG + Exonic
1033692868 7:143755699-143755721 AATGACTTCTTTGGATAAAATGG - Exonic
1033731543 7:144185441-144185463 AATGACTTCTTTGGATAAAATGG + Exonic
1033740121 7:144267291-144267313 AATGACTTCTTTGGATAAAATGG - Exonic
1034921079 7:155082638-155082660 ATTGCCGTCTTGGGACAATATGG + Intronic
1035543053 8:457095-457117 ATCGACCTATTGGGAACAAAAGG + Intronic
1036710473 8:11075163-11075185 CTTGAACTCTGGGGAAAAAAAGG + Intronic
1038191585 8:25326003-25326025 CCTGACTGCTTGGAAAAAAATGG - Intronic
1038858624 8:31360847-31360869 ATTGACTATTTAGGCAAAAATGG + Intergenic
1041444660 8:57937513-57937535 GTTGACCTCTTGGGGAAAAATGG + Intergenic
1041765722 8:61416227-61416249 GTTGAAATCTAGGGAAAAAATGG - Intronic
1041843539 8:62299570-62299592 CTTGACTTCATATGAAAAAAAGG - Intronic
1043100464 8:76038837-76038859 AATGACTCCTTGGAAAAAGAAGG - Intergenic
1043167794 8:76926089-76926111 AGTGACATCTTGGGAAAGCAAGG - Intergenic
1046086459 8:109443018-109443040 AATGACTCCTTGGAGAAAAATGG - Exonic
1046178463 8:110610554-110610576 ATTCCCTTCTTTGGTAAAAATGG - Intergenic
1046189134 8:110766626-110766648 ATTGATTTCAAGAGAAAAAAAGG + Intergenic
1046305719 8:112363993-112364015 ATTGATTATTTGGGAAAAACAGG - Intronic
1046697367 8:117357103-117357125 ATTACCTTATTTGGAAAAAAGGG - Intergenic
1046748967 8:117906749-117906771 GTTGTCTCCTTGGGAAAGAATGG + Intronic
1047921191 8:129636161-129636183 ATTGAAACCTTGGGAGAAAAGGG + Intergenic
1048679987 8:136830795-136830817 AATGATTTCTGGAGAAAAAAGGG - Intergenic
1049304730 8:141895053-141895075 GTTGACTTCTTGGGAAACAGGGG + Intergenic
1052421739 9:28251233-28251255 TCTGGGTTCTTGGGAAAAAAAGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1055042357 9:71888760-71888782 ATTTACTGCTTGGTAAATAAGGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056342329 9:85648854-85648876 AATGACTGCTTGGAAAGAAAGGG + Intronic
1056488614 9:87083942-87083964 ATTGATTCCTTGGAGAAAAAAGG + Intergenic
1058489647 9:105483340-105483362 ATTGACTTCTTGGGTAGATTTGG + Intronic
1059806686 9:117808953-117808975 ATTGACTTCTTAGGATGAATTGG - Intergenic
1062065107 9:134522497-134522519 AGGGGCTTCTGGGGAAAAAACGG - Intergenic
1186452508 X:9685237-9685259 CTTGACTTCTGGGGAATAATGGG + Intronic
1186570023 X:10705255-10705277 ATTGACTTCATAGTAACAAAGGG - Intronic
1186731038 X:12409930-12409952 ATTGAATACTTGAGAAAAAAGGG - Intronic
1188356701 X:29200579-29200601 ATTATTTTATTGGGAAAAAATGG - Intronic
1188539093 X:31229723-31229745 TTTGGCTTCTTGGGAAAATTTGG - Intronic
1189226142 X:39414852-39414874 TTTTATTTCTTGGGGAAAAAAGG + Intergenic
1193407875 X:81124531-81124553 ATGGAGTGGTTGGGAAAAAAAGG - Intronic
1193900745 X:87173769-87173791 CTTGATATTTTGGGAAAAAAAGG - Intergenic
1193946923 X:87749437-87749459 ATTTACTTCTTGCGAGAGAAAGG + Intergenic
1194201816 X:90960904-90960926 ATTGACTTTTGGGTAAATAATGG + Intergenic
1194809637 X:98374898-98374920 ATGGATTTATTGGGCAAAAAGGG + Intergenic
1196083847 X:111662382-111662404 AGTGACTTCACGAGAAAAAATGG - Intergenic
1196224452 X:113149129-113149151 TTTGACTTCTGTGGATAAAAGGG + Intergenic
1196577744 X:117339569-117339591 ATTGCCTTCTAGGGAAAGATAGG + Intergenic
1196838248 X:119833231-119833253 TTTGATTTCTTTGGAAATAAAGG - Intergenic
1197133032 X:123027415-123027437 AATGACTTCTGGGTAAATAATGG - Intergenic
1199098609 X:143770886-143770908 AATGACTTCTTGGTAAATGATGG + Intergenic
1199874900 X:151921654-151921676 GTTGACTGCAGGGGAAAAAATGG - Intronic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1200293167 X:154890850-154890872 ATAGTCTTCATGGAAAAAAATGG + Intronic
1200547654 Y:4536356-4536378 ATTGACTTTTGGGTAAATAATGG + Intergenic
1200825970 Y:7641537-7641559 ATTGTTTTTTTGGAAAAAAAAGG + Intergenic
1201547333 Y:15180103-15180125 ATGGAATTCTTTGGAAAAGAGGG + Intergenic
1202095516 Y:21245066-21245088 ATTGGCTTCTTGTGACAAAAGGG + Intergenic