ID: 1083104466

View in Genome Browser
Species Human (GRCh38)
Location 11:60344781-60344803
Sequence ATGAAGTAGCTGAAGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 1, 2: 13, 3: 49, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083104466_1083104473 30 Left 1083104466 11:60344781-60344803 CCTATTTCCTTCAGCTACTTCAT 0: 1
1: 1
2: 13
3: 49
4: 377
Right 1083104473 11:60344834-60344856 GCACTGTTATCTTTCATGGAAGG 0: 1
1: 0
2: 1
3: 5
4: 134
1083104466_1083104472 26 Left 1083104466 11:60344781-60344803 CCTATTTCCTTCAGCTACTTCAT 0: 1
1: 1
2: 13
3: 49
4: 377
Right 1083104472 11:60344830-60344852 TGTAGCACTGTTATCTTTCATGG 0: 1
1: 0
2: 0
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083104466 Original CRISPR ATGAAGTAGCTGAAGGAAAT AGG (reversed) Intronic
900942382 1:5808359-5808381 CTGAAGAAGCTGAAGGCACTGGG + Intergenic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901587416 1:10309287-10309309 ACAAAGTACCTGAAGGAAAAGGG - Intronic
902603376 1:17555113-17555135 ATGACGCAGCTAAAGGAACTTGG - Intronic
904181781 1:28670870-28670892 ATGTATTTGCTGAAGTAAATAGG - Intronic
904203655 1:28838353-28838375 TTGAAGAAGCAGAAGGAACTTGG + Intronic
904586850 1:31585452-31585474 ATGAAGGAGCTGATGGAGAATGG + Exonic
905470300 1:38186801-38186823 ATGAGGTACATGAAGGAACTGGG - Intergenic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
906433917 1:45778865-45778887 ATGAAGTAGGTCAAATAAATGGG + Intergenic
906506324 1:46382558-46382580 ATGAAGTAACTGAAGACAAATGG - Intergenic
906666361 1:47624896-47624918 ATGAAGTTGCTGAGGTTAATGGG - Intergenic
907136510 1:52143258-52143280 AATAAATACCTGAAGGAAATGGG + Intronic
907481800 1:54750103-54750125 ATGAAGTTGAAGAAGGAATTGGG + Intergenic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908176579 1:61561595-61561617 ATGAAGTCGGTAAAGGGAATGGG + Intergenic
908689794 1:66765909-66765931 CAGAAGTAGCTGCATGAAATTGG - Intronic
909303236 1:74039352-74039374 CTGGAGTACCTGAAGGAGATGGG + Intronic
909717226 1:78724017-78724039 AGGAAGTAATTAAAGGAAATAGG - Intergenic
911270028 1:95790070-95790092 ATGAAGTAGGTGAAGGGGATGGG + Intergenic
912037408 1:105335725-105335747 ATAAAGTAGCTGGGGGAATTGGG + Intergenic
912609761 1:111031031-111031053 ATGAGGTAGCCAAAGAAAATAGG + Intergenic
916307328 1:163352431-163352453 ATGAATGAACTGAAGGAAAATGG - Intronic
916374677 1:164139440-164139462 ATGAAGTCTTTGAAGGAAAAGGG + Intergenic
917356275 1:174130085-174130107 TTGGAGTACCTGAAGGAGATGGG - Intergenic
917779948 1:178383649-178383671 ATGAAATAGTAGGAGGAAATGGG - Intronic
917862502 1:179160581-179160603 ATAAGGAAGATGAAGGAAATTGG - Intronic
918168896 1:181976329-181976351 TTGGAGTACCTGAAGGAAAGGGG + Intergenic
918955384 1:191200238-191200260 CTGGAGTACCTGAAGGAGATGGG + Intergenic
922086101 1:222348270-222348292 ATGAAGGACATGAAGGAAACTGG + Intergenic
922349323 1:224722754-224722776 ATGAGGAAGCTTAAAGAAATGGG + Intronic
923387280 1:233477595-233477617 ATGAAAGAACTCAAGGAAATGGG - Intergenic
923454335 1:234150266-234150288 CTTAAGAAGCTCAAGGAAATTGG - Intronic
1063250091 10:4264567-4264589 ATGACGCAGCTTATGGAAATGGG - Intergenic
1063427235 10:5959998-5960020 ATGGAGGAGCTGAGGGTAATGGG - Intronic
1065171614 10:23035807-23035829 GCCCAGTAGCTGAAGGAAATAGG - Intronic
1065830664 10:29610982-29611004 ATGAAGTAGCTGATGGCTCTGGG - Intronic
1065839722 10:29692368-29692390 AGGAAGTGGCTGAATGCAATGGG - Intronic
1066105489 10:32152817-32152839 ATGTAGTTATTGAAGGAAATTGG - Intergenic
1066594023 10:37028939-37028961 ATGAAGAATCTGACAGAAATTGG + Intergenic
1066600724 10:37103800-37103822 ATAATGTAGATGAAGAAAATGGG + Intergenic
1066601476 10:37112434-37112456 ATAATGTAGATGAAGAAAATGGG - Intergenic
1067075957 10:43182441-43182463 ATGAAATTACTGAAGGAATTTGG - Intronic
1067606354 10:47667009-47667031 ACAAAGTAAGTGAAGGAAATGGG - Intergenic
1068461964 10:57340956-57340978 ATAAAGTAGCCAAAGGAAATAGG - Intergenic
1070333795 10:75437062-75437084 ATGAAGTTACTGAAGGAGAGTGG + Intronic
1070625631 10:78049098-78049120 ATGAATGAGCTGAAGGACTTGGG - Intronic
1070855553 10:79605767-79605789 ATGAAATAGCTGAGGGAAACGGG - Intergenic
1071621914 10:87128362-87128384 ACAAAGTAAGTGAAGGAAATGGG - Intronic
1072813085 10:98478747-98478769 AGGGAATAGCTGAAGGAAATGGG - Intronic
1073729694 10:106273284-106273306 ATGAAATAGCCAAGGGAAATAGG + Intergenic
1075261688 10:120968902-120968924 ATCAAGTAGCTAAGGGAAAGGGG - Intergenic
1076814582 10:132908471-132908493 ATCAAGTACCTGAAGAAATTTGG - Exonic
1079074516 11:17375716-17375738 ATGAAATAGCGAAAGGAAACAGG + Exonic
1079218462 11:18537235-18537257 ATGATGTAGTAAAAGGAAATGGG - Intronic
1080130741 11:28791929-28791951 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1080234948 11:30057579-30057601 ATCAAGGAGCTGTAAGAAATGGG - Intergenic
1080974932 11:37327734-37327756 AAGAACTCGCTGAAGGACATAGG - Intergenic
1081101714 11:39010335-39010357 ATGGAGAAGCCAAAGGAAATAGG - Intergenic
1081522907 11:43899981-43900003 TTGAAGTATATGAAGGAAATTGG - Intronic
1082117095 11:48339874-48339896 AAGAGGTAGCTGACAGAAATAGG - Intergenic
1082256580 11:50039258-50039280 AAGAGGTAGCTGACAGAAATAGG + Intergenic
1083065620 11:59921195-59921217 CTGATGTATCAGAAGGAAATAGG - Intergenic
1083104466 11:60344781-60344803 ATGAAGTAGCTGAAGGAAATAGG - Intronic
1083591787 11:63899793-63899815 AGGAAGGAGCTGAGGGGAATGGG - Intronic
1084854307 11:71972060-71972082 ATTAAGTACCTGTAGGAACTTGG + Intronic
1085889660 11:80563114-80563136 ATAATGTAGATGAAGAAAATGGG - Intergenic
1085894288 11:80619368-80619390 ATGAAGAATCTGACAGAAATTGG - Intergenic
1086002389 11:81998720-81998742 ATGAAATAGCTGAGGGAAACAGG - Intergenic
1086084446 11:82940341-82940363 ATGATGTACCTAAAGGAATTAGG + Intronic
1086458502 11:86982910-86982932 ATGAAGCAGCTAAAGGGATTAGG + Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088020542 11:105112985-105113007 TTGAAGTACCTGAAAGAGATGGG + Intergenic
1088697882 11:112383899-112383921 TTGGAGTAACTGAAGGAGATGGG + Intergenic
1090189009 11:124756345-124756367 ATGGAGGAGCTGGAGGAACTGGG + Exonic
1091158196 11:133393715-133393737 CTGAAGATGATGAAGGAAATTGG - Intronic
1092337220 12:7643706-7643728 ATGAGGTAGCCAAAGGAAATAGG + Intergenic
1092648819 12:10610927-10610949 ATGATGTAGCTTAAGAAAATAGG - Intronic
1092912804 12:13163085-13163107 ATGAAACAGGTGAAGGAATTAGG + Intergenic
1095578536 12:43767418-43767440 ATGGAGTAGCAGAAGTAAAGGGG + Intronic
1095595464 12:43952668-43952690 TTGAAGTACCTGAAAGAGATGGG + Intronic
1097923664 12:65104939-65104961 ATGAAGTAGCTGAAGAAATTGGG + Intronic
1097997323 12:65903132-65903154 ATAAAGCAGCTGAAGGGAAATGG - Intronic
1098215583 12:68213921-68213943 ATAATGTATCTGAAGGAACTGGG - Intronic
1099869120 12:88324004-88324026 CTGAATTAGCTGTAGGAATTAGG - Intergenic
1099906800 12:88780602-88780624 TTAAAGTAGCAGGAGGAAATGGG - Intergenic
1100067059 12:90661892-90661914 ATAAAGTAGATGAAGGGGATAGG + Intergenic
1100389774 12:94138325-94138347 ATGAAGAAACAGAAGTAAATCGG + Intergenic
1100473298 12:94913141-94913163 TTGCAGTAGCTTAAGGAAAATGG - Intronic
1100795801 12:98180657-98180679 GTGAAGTAGGTGATGGAACTTGG - Intergenic
1101528931 12:105556924-105556946 CTGAGGTAGAGGAAGGAAATGGG - Intergenic
1103320873 12:120092332-120092354 GTGAGGAAGCTGAAAGAAATGGG + Intronic
1104654876 12:130567048-130567070 ATGAAAGAGGTGAAGGAAGTTGG + Intronic
1106071136 13:26412253-26412275 TAGCAGTAGCTGAAGGAAAAGGG - Intergenic
1107097602 13:36553129-36553151 ATGAAGGAGCTGAGGGACAGTGG + Intergenic
1107243638 13:38266476-38266498 TTGAAGTACCTGAAAGAAATGGG + Intergenic
1108315503 13:49233147-49233169 ATGTAATAACTGAAGGAAATGGG + Intergenic
1108475103 13:50808299-50808321 CTGAGGCAGCTGAAAGAAATTGG + Intronic
1110242700 13:73286550-73286572 AGTAAGTAGATGAATGAAATAGG - Intergenic
1110386321 13:74915071-74915093 ATATAGTAGCTGAAGTAAGTAGG - Intergenic
1110462193 13:75757381-75757403 ATTAAGCAGCTTAAGGGAATAGG - Intronic
1112216673 13:97437738-97437760 ATGAAGGATCTGATGGAAAAGGG + Intronic
1114423406 14:22603262-22603284 AGGAAGGAGCTGAGGGAAGTTGG + Intronic
1115257008 14:31413825-31413847 ATGAAGTAGTTGAAAGAATGTGG - Intronic
1116141304 14:40997959-40997981 ATGAAGTAGATGAACAAATTTGG - Intergenic
1116298485 14:43143745-43143767 ACGAAGTAGCTCTAGGATATTGG - Intergenic
1117610073 14:57473997-57474019 AAGAAGTAGCTGGATGAAGTGGG - Intronic
1117646039 14:57853896-57853918 TTGAACTAGCTGAAGCAAAATGG - Intronic
1117982774 14:61358367-61358389 ATTAAGGAGCTAAAGGAAAATGG - Intronic
1118378115 14:65194271-65194293 ATGGAGTACCAGGAGGAAATGGG - Intergenic
1118435441 14:65766936-65766958 ATGAAGTAGGGGATGGAACTGGG - Intergenic
1118554327 14:66997965-66997987 ATGAAGTGGCAAAAAGAAATGGG - Intronic
1118596020 14:67436292-67436314 ATGGAGTAGCTGGGGGATATTGG + Intergenic
1119346715 14:73931112-73931134 CTCAAGTAGGAGAAGGAAATAGG - Intronic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120267795 14:82273803-82273825 ATGAAGTAACTTAAGGAAGCTGG - Intergenic
1120301372 14:82711679-82711701 ATCAAGAAACTGAAGAAAATAGG - Intergenic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1122642699 14:103169804-103169826 ATGAAGTAGGCGAGGGAAATAGG + Intergenic
1123963392 15:25431266-25431288 ATGAAGCAGCTTAAGTAATTAGG + Intronic
1124487175 15:30128839-30128861 ATGGAGTAGCTGTAGAAGATGGG + Intergenic
1124548967 15:30659919-30659941 ATGGAGTAGCTGTAGGAGATGGG + Intronic
1124756350 15:32409484-32409506 ATGGAGTAGCTGTAGAAGATGGG - Intergenic
1126485781 15:49178926-49178948 AGCAAGAAGCTGAAGGAAAGTGG - Intronic
1127347625 15:58116419-58116441 TTGAAGCAGGTGATGGAAATTGG - Intronic
1127420424 15:58799652-58799674 CTGAAGTACCCCAAGGAAATGGG + Intronic
1127755814 15:62090833-62090855 ATGCAGTAGTTGAAGAACATTGG + Intergenic
1127820649 15:62652622-62652644 AAGAAGTGTCTGAAGGAACTAGG - Intronic
1128048420 15:64640583-64640605 ATGACCTAGCAGAAGGAACTAGG - Intronic
1129003876 15:72356040-72356062 AGGAAGTAGCTGAAGCATAGAGG - Intronic
1129007908 15:72389841-72389863 ATGAAGCAGATGCAGGAAAAGGG - Intergenic
1129077368 15:73008431-73008453 AAGGTGTTGCTGAAGGAAATTGG - Intergenic
1129824957 15:78628879-78628901 ATGAATTAACTGCAGGAAGTGGG + Intronic
1129932775 15:79426155-79426177 ATGCAGGAACTGAAGGAAACTGG + Intronic
1130053778 15:80505599-80505621 ATGAGGTAGCTGAAGCACAGAGG + Intronic
1130160922 15:81399134-81399156 ACTAAGCAGCTGAAGGAATTGGG - Intergenic
1130710481 15:86275903-86275925 ATGAAGAATCTGAAAGAAGTTGG - Intronic
1130803343 15:87291166-87291188 AGTAAGGAACTGAAGGAAATTGG - Intergenic
1131939416 15:97544532-97544554 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1132231284 15:100186130-100186152 ATGAAGTATGTGAAGGAAGTAGG + Intronic
1133368863 16:5232908-5232930 AAGAAGAAGAAGAAGGAAATGGG - Intergenic
1134199724 16:12187895-12187917 CTGATGCAGCTGAGGGAAATCGG + Intronic
1137638928 16:50011470-50011492 ATGGATTTGCTGATGGAAATGGG + Intergenic
1138841858 16:60519070-60519092 ATGATGTATCTCAAGGAATTAGG + Intergenic
1139093025 16:63671914-63671936 ATGAAGAAGCAAAAGGAAAGAGG - Intergenic
1141921115 16:87136073-87136095 CTGAAATTGGTGAAGGAAATGGG + Intronic
1142173004 16:88632553-88632575 AGGAAGTAGATGAGGGAGATGGG - Intergenic
1144301727 17:13927639-13927661 ATGAAATAGCTGAGGGAAATGGG + Intergenic
1146278756 17:31531602-31531624 TTCCATTAGCTGAAGGAAATGGG - Exonic
1148923182 17:51058389-51058411 ATGAGGAAACTGAAGCAAATAGG + Intronic
1149242016 17:54662116-54662138 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1150370268 17:64631416-64631438 ATGCAGGGGTTGAAGGAAATGGG + Intronic
1152969389 18:147226-147248 ATGGTGTAGCTGAAAGACATCGG + Intergenic
1152996688 18:413993-414015 AAGAAGTAGGTGGAGGAAAGGGG + Intronic
1153095860 18:1402029-1402051 GTGAAGTAGGTGAAGGCAAAAGG + Intergenic
1155534935 18:26807357-26807379 ATGGAGAAGTTGCAGGAAATTGG + Intergenic
1155583153 18:27335100-27335122 ATGAAGGAGTTGAAGGTAATAGG + Intergenic
1155839356 18:30627836-30627858 ATGAAAAAGCTGAAGGAAATAGG - Intergenic
1156778620 18:40823174-40823196 TTCAAGTACCTGAAGGAGATGGG + Intergenic
1157040986 18:44038506-44038528 GTGGAGTAGCTAAAGGAAACTGG + Intergenic
1158507378 18:58058587-58058609 AAGAATTAACTGAAGGAATTTGG + Intronic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159263811 18:66052401-66052423 ATGAACTAACTAAAGGAAACCGG - Intergenic
1159646304 18:70922198-70922220 TTGCAGTATCTGAAAGAAATGGG + Intergenic
1160253588 18:77226666-77226688 ATGAAGAAACTGATGGATATGGG + Intergenic
1160327121 18:77960891-77960913 ATTAAAAAGCTGATGGAAATGGG - Intergenic
1163877764 19:19889142-19889164 ATGAAGAAGCTGAACAAACTAGG - Intronic
1166438638 19:42791009-42791031 ATGATGTAGCCAAAGGAAATAGG - Intronic
1166473661 19:43101798-43101820 ATGAAGTAGACAAAGGAAATAGG - Intronic
1166487602 19:43226863-43226885 ATGAAGTAGCCAAAGGAAATAGG - Intronic
1166494441 19:43288735-43288757 ATGAAGTAGCCAAAAGAAATAGG - Intergenic
1168284916 19:55326343-55326365 ATGAGGTTGCTGAAGGATAAAGG + Intronic
925722394 2:6841756-6841778 ATGAAATAGCTGAAGGAAATAGG - Intronic
926455983 2:13069201-13069223 GGGAAATAGCTGATGGAAATGGG + Intergenic
927172707 2:20383657-20383679 CTGAAGTAGCTAAAGCAAAGAGG - Intergenic
927302639 2:21533894-21533916 ATAAAGTAAATGAAGTAAATTGG - Intergenic
928336930 2:30406246-30406268 ATGAAGAAGTGGAAGGAATTTGG - Intergenic
928616363 2:33043662-33043684 AGGAAGTAGAAGAAGGAATTTGG + Intronic
928789325 2:34932333-34932355 AGGAGGCAGCTGATGGAAATGGG - Intergenic
929244605 2:39687520-39687542 ATGAAAAAGGTGCAGGAAATGGG - Intronic
929680890 2:43992598-43992620 ATGAAGGGGCTGGAGGAAAAGGG + Intronic
930238417 2:48909839-48909861 ATGAAATAGCCTTAGGAAATAGG - Intergenic
930545930 2:52767014-52767036 TTGGAGTACCTGAAGGAGATGGG + Intergenic
930646204 2:53911062-53911084 AAAAAGTAGCTGAATTAAATGGG + Intronic
930771176 2:55132096-55132118 AAGTAGAAGCTGGAGGAAATCGG + Intergenic
933602377 2:84346666-84346688 TTGGAGTACCTGAAGGAGATGGG - Intergenic
936946836 2:117938701-117938723 AGGAACCAGCTGAATGAAATGGG - Intronic
937570965 2:123360850-123360872 CTGAAGTTGCTGATGAAAATGGG - Intergenic
938014841 2:127858434-127858456 TTTAAGTCGGTGAAGGAAATTGG - Intergenic
938088439 2:128417034-128417056 AGGAAGCAGCTGAAGGAACCTGG + Intergenic
939005475 2:136781736-136781758 GTGAAGTAGCTGGAGGACAGAGG - Intronic
939545518 2:143547770-143547792 ATGAAGGAGATGAAGAAACTAGG + Intronic
941017004 2:160368974-160368996 AGGAAGAATCTGAAGGATATAGG - Intronic
941591045 2:167420844-167420866 ATGAAGTAGAGGAAGGACATAGG + Intergenic
941727329 2:168876421-168876443 ATGTAGTAGCATAAGTAAATAGG + Intronic
942516582 2:176760279-176760301 ATGAACTAGATGAAGGCATTGGG - Intergenic
942579026 2:177396459-177396481 ATGAAGCAGCTGAAGGGGCTTGG + Intronic
942832924 2:180257811-180257833 ATGAAGAAGCTGAGGGACAGAGG + Intergenic
943382914 2:187172896-187172918 ATGAAATAGCCAAAGGAAATAGG - Intergenic
944196434 2:197059165-197059187 ATGTAGCAGCTGAGGGACATGGG + Intronic
944420539 2:199525371-199525393 ATATAGTTGCTGAAAGAAATAGG + Intergenic
945457790 2:210069248-210069270 GTGAAGTTTCAGAAGGAAATGGG - Intronic
945497298 2:210524636-210524658 ATGAATTAGCTAAGGGAGATTGG - Intronic
945639633 2:212407534-212407556 ATGAAGTAGCTGTAGTACAGTGG - Intronic
946443490 2:219717414-219717436 TTAAAGTTGGTGAAGGAAATAGG + Intergenic
947079428 2:226379654-226379676 ATGATGTAGCTCAAGGAAAGAGG - Intergenic
947235368 2:227935887-227935909 ATGAAGAATCAGAAGAAAATTGG + Intergenic
947352011 2:229256089-229256111 ATGAAGGAGCTGAACTACATTGG + Intronic
947852861 2:233302555-233302577 ATGGAGGAGTTGATGGAAATGGG + Intergenic
1169700720 20:8443711-8443733 ATGCAGAAGCAGAAGGGAATAGG - Intronic
1169794721 20:9449374-9449396 AGGAAGTAGCTGAGGGAAGTTGG + Intronic
1170401480 20:15989010-15989032 ATGAAGAACCTGAAGCAGATAGG - Intronic
1170496749 20:16932149-16932171 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1170973598 20:21140121-21140143 AGGAAGAAGCAGAAAGAAATGGG - Intronic
1171149528 20:22815006-22815028 AGGAAGCAGCTGGAGGAGATGGG + Intergenic
1171353978 20:24529607-24529629 TTTAAGTAGTTGAAGAAAATAGG - Intronic
1171818144 20:29807030-29807052 ATGAAGTAGCTTAGGTCAATAGG - Intergenic
1172860452 20:38046009-38046031 TTCAAGTAGCTGAAGTATATGGG - Intronic
1172912952 20:38423609-38423631 GGGCAGGAGCTGAAGGAAATAGG + Intergenic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1177125059 21:17184179-17184201 ATAAAGTAACTGAGGGAAATAGG + Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178665502 21:34542989-34543011 ATGAAGAATCTGAAGCACATGGG - Intronic
1181426556 22:22846852-22846874 ATGAAGTAAATGCAGTAAATGGG + Intronic
1182000533 22:26916026-26916048 ATCATGTTACTGAAGGAAATAGG + Intergenic
1182021528 22:27085699-27085721 ATGATGCAGCTCAAGGAAGTGGG - Intergenic
1183074883 22:35420517-35420539 ATAAAGTAGCTTAAAGAAATAGG + Intronic
949119765 3:372223-372245 TTGGAGTACCTGAAGGAGATGGG - Intronic
950247390 3:11433613-11433635 ATGAAGTATTTCAGGGAAATTGG - Intronic
950354280 3:12391446-12391468 TTGAAGGCGATGAAGGAAATAGG + Intronic
950563461 3:13749381-13749403 ATGAAGTAGAACAGGGAAATAGG - Intergenic
951431720 3:22615797-22615819 ATGAAGTGGCTAAGGGAAAAAGG - Intergenic
951849626 3:27124691-27124713 AAGAATTAGCTGAAGGAAAACGG + Intronic
952607825 3:35171572-35171594 TTGGAGTACCTGAAAGAAATGGG - Intergenic
953311326 3:41882775-41882797 ATGGAGTAGCTGTAGGAGATGGG - Intronic
953819533 3:46193338-46193360 GTGAAGCAGGTGAAAGAAATGGG + Intronic
955269981 3:57487708-57487730 ATAAACTAGGTGAAGGAAACTGG + Intronic
955314539 3:57925308-57925330 AAGAAACAGCTGAAGGCAATGGG - Intronic
956557320 3:70538282-70538304 ATGAAATAGCCGAGGGAAATAGG - Intergenic
956754850 3:72374327-72374349 ATGATGTAAAGGAAGGAAATGGG - Exonic
957495763 3:80989761-80989783 ATGAAGTTGCTGAAGCAATATGG - Intergenic
957515045 3:81239455-81239477 AGGAAGTAGCAGAAGAAAACAGG + Intergenic
957519348 3:81298716-81298738 ATGAAGCAACTTAATGAAATGGG + Intergenic
957629935 3:82706018-82706040 TTGGAGTACCTGAAGGAGATGGG - Intergenic
957911174 3:86621527-86621549 ATGAAGCAGCAGAAGGAAATAGG + Intergenic
959232334 3:103670567-103670589 ATGAAATAGCTGAAGATAAAAGG - Intergenic
959316587 3:104815808-104815830 AGGTAGTAACAGAAGGAAATGGG + Intergenic
959420339 3:106120522-106120544 ACGGAGGAGCTGCAGGAAATGGG + Intergenic
960260876 3:115567063-115567085 ATGAAGGAGATGAAGGAGACTGG + Intergenic
960567220 3:119146407-119146429 ACGGAGTAGCTGAACAAAATGGG + Exonic
961184572 3:124903351-124903373 ATTAGGTAGTTGAAGGAAACGGG + Intergenic
961909803 3:130302595-130302617 GGGAGGTAGCTGATGGAAATGGG + Intergenic
962146829 3:132848415-132848437 AGGAAGAAACTGAAGCAAATGGG - Intergenic
962262282 3:133919534-133919556 AGGTAGGAGATGAAGGAAATAGG - Intergenic
963761902 3:149293217-149293239 ATGAAATAGTTGAGGGAAATAGG + Intergenic
964102764 3:153006656-153006678 ATGAAGAAACTGAAGGCAAGAGG - Intergenic
964707039 3:159630015-159630037 ATAAGGCAGATGAAGGAAATTGG + Intronic
964795694 3:160494502-160494524 ATGAAGAAACTGAAGCACATAGG + Intergenic
965299949 3:166996685-166996707 ATGAAATAGCTGAGGAAAATAGG - Intergenic
966238175 3:177726043-177726065 ATGAAGGAGAGGAGGGAAATGGG - Intergenic
966802226 3:183774993-183775015 ATGAAGGTGGAGAAGGAAATTGG + Intronic
966964985 3:184982106-184982128 TTGACATAGCTAAAGGAAATTGG + Intronic
967019252 3:185508078-185508100 ATGGAGGAGCTGGAGGAGATGGG - Exonic
967329472 3:188276299-188276321 ATGAAGTAGATGAAGGTTGTTGG + Intronic
970015747 4:11510568-11510590 TTGAAGTAGCTGAGAGGAATAGG - Intergenic
970254826 4:14156398-14156420 AGGAAGCAGCTAAAGGAATTAGG - Intergenic
970421928 4:15913014-15913036 AGGAAGCAGGAGAAGGAAATTGG + Intergenic
970466766 4:16331755-16331777 ATGAGGTAACTGAAGAAAAGTGG - Intergenic
971457682 4:26860104-26860126 ATGAATTAGCTGTGGGATATTGG + Intronic
971516795 4:27497336-27497358 TTGGAGTACCTGAAGGAGATGGG + Intergenic
971746298 4:30585857-30585879 TTGGAGTAGCTGAAAGAGATGGG - Intergenic
972818574 4:42672952-42672974 TTGAAGAAGCTGAAAGAACTTGG + Intergenic
974741318 4:66012015-66012037 TTGAAGTAACAAAAGGAAATGGG - Intergenic
974754936 4:66191343-66191365 AGGAAGTAGATGAAGAACATAGG - Intergenic
977470258 4:97434663-97434685 ACAAACTAGCTGAAGCAAATAGG + Intronic
978215027 4:106189873-106189895 CTGAAACAGCTGAAGGAAGTTGG - Intronic
978284071 4:107053854-107053876 TTGAAGTAGCTTAAGTAAAAAGG - Intronic
979906856 4:126304639-126304661 AGGAAATGCCTGAAGGAAATAGG - Intergenic
980293576 4:130877971-130877993 AGGAAGTAGGAGATGGAAATAGG + Intergenic
980299819 4:130974734-130974756 ATGAAGTAATTTAAGTAAATTGG - Intergenic
980788268 4:137582629-137582651 ATGAAGAAGCTGGAAGAAATGGG + Intergenic
981763445 4:148219656-148219678 TTGAAGTATATGAAGAAAATTGG - Intronic
982263196 4:153514061-153514083 ATGCAGTATCTGAGGGAAACTGG - Intronic
982528384 4:156507119-156507141 TTGGAGTACCTGAAGGAGATGGG + Intergenic
982594863 4:157368346-157368368 CTGAATTAGCTGAATGAATTTGG + Intergenic
983354593 4:166639274-166639296 ATTAAGAAACTGAAGGAAACTGG - Intergenic
985700854 5:1371420-1371442 AAGAGGCAGCTGACGGAAATGGG + Intergenic
986403155 5:7398510-7398532 ATGATTTAGCTGAAGGCAAGAGG - Intronic
986491793 5:8299887-8299909 ATGAGGTAGCTGAAGGAATTAGG - Intergenic
987785724 5:22496070-22496092 ATGTTGTAGGTGAAAGAAATGGG + Intronic
988246748 5:28694202-28694224 AAGAAGTAGCTGAAAGAATATGG + Intergenic
988977304 5:36527989-36528011 AAGGAGTAGCTGAAATAAATAGG + Intergenic
989029771 5:37106814-37106836 ATGAAGTAGTTGAAGGATACTGG + Exonic
989059202 5:37393432-37393454 ATGATGTACCTCAAGGAACTAGG - Intronic
990349219 5:54899163-54899185 TTGAAGAAGCAGAAGGGAATGGG - Intergenic
991422858 5:66459061-66459083 ATAAAGTATCTGAAGCAATTGGG + Intergenic
992398411 5:76388685-76388707 ATGAAATAGCTGAATGAAGAAGG - Intergenic
993365391 5:87029065-87029087 TTGGAGTACCTGAAGGAGATCGG - Intergenic
993587172 5:89745830-89745852 TTGAAGTACCTGAAAGAGATGGG - Intergenic
993943883 5:94095476-94095498 ATGGAGTTGAAGAAGGAAATAGG - Intronic
994061479 5:95483136-95483158 AAACAGTAGCTTAAGGAAATGGG - Intronic
994774974 5:104029194-104029216 ATGAAGTAACTGAGGGAAATTGG + Intergenic
995419938 5:111953173-111953195 ATGCATTGGTTGAAGGAAATTGG - Intronic
996287566 5:121812645-121812667 TTGGAGTACCTGAAGGAGATGGG - Intergenic
996513272 5:124341609-124341631 ATGAAATTGCTGTAGGAAAATGG - Intergenic
996697794 5:126418085-126418107 TTGAAATAGCAGCAGGAAATAGG + Intronic
997888864 5:137657598-137657620 ACGAAGCAGAGGAAGGAAATGGG - Intronic
998987721 5:147780564-147780586 ATGAAGTAGGGCAAGGAAAGAGG - Intronic
999371232 5:151056565-151056587 ATGAGGAAGAGGAAGGAAATGGG - Intronic
1000497717 5:162006439-162006461 TTGGAATAGCTGAAGGAAAATGG + Intergenic
1000734807 5:164885949-164885971 CTGATGGAGCTGAAGGAAGTGGG - Intergenic
1000763173 5:165252056-165252078 ATGATGGAGCTGAAGTAAAGGGG + Intergenic
1003140891 6:3470281-3470303 ATGAACTAGGTGGAGGAAAAGGG - Intergenic
1003248909 6:4407168-4407190 CTGGAGTACCTGAAGGAGATGGG + Intergenic
1004560526 6:16744910-16744932 GGGAAGTAGCTGTAGCAAATAGG + Intronic
1005688079 6:28274350-28274372 ATAAAGTAGCTGAAAGAAAGGGG + Intronic
1005948376 6:30612313-30612335 ATTTAGTGTCTGAAGGAAATAGG - Intronic
1006289043 6:33120239-33120261 ATGAAGTAGCCAAAGGAAATAGG - Intergenic
1007817603 6:44535546-44535568 CTGCTGTAGCTGAAGGAAATGGG + Intergenic
1008875142 6:56317816-56317838 ATCAAGTAGGTGAAGGAAGGTGG - Intronic
1009439346 6:63657979-63658001 TTGAATGAACTGAAGGAAATAGG - Intronic
1009728449 6:67565288-67565310 ATGAAGTAGGTTAAGAGAATAGG - Intergenic
1010801053 6:80176099-80176121 CTGGATTAGCAGAAGGAAATGGG + Intronic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011587354 6:88941113-88941135 GTCAAGTTGCTGAAGAAAATCGG - Exonic
1011587617 6:88943734-88943756 CTGAAAGAGCTGATGGAAATAGG - Intronic
1011698571 6:89934724-89934746 ATGAAGTGGATGAAGAAAAGGGG + Intronic
1011873397 6:91925625-91925647 ATTAAGCAGCGGAAGAAAATAGG - Intergenic
1013097548 6:106959340-106959362 ATGAAGAAACTGAAAGACATTGG - Intergenic
1013582803 6:111552665-111552687 AGGAAGGGGCTGATGGAAATCGG - Intergenic
1014269364 6:119319518-119319540 ATAAAATAGCTGAAGAAAATTGG - Intronic
1014276595 6:119396307-119396329 ATGAAGTGGCCAAGGGAAATAGG - Intergenic
1014445578 6:121523541-121523563 GTGAAGTAGATAAAGGAAAGAGG + Intergenic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1015460851 6:133488754-133488776 TTGAGGTATCTGAAGGAACTTGG - Intronic
1018160161 6:161032776-161032798 ATAATGTAGTTTAAGGAAATAGG + Intronic
1018410215 6:163537762-163537784 TTGAAGTAGGTAAAGGCAATGGG - Intronic
1018524909 6:164699127-164699149 ATGAAGTTGCTGGTTGAAATTGG - Intergenic
1019043192 6:169122981-169123003 ATGAAGTGGCTGAGGGAAATAGG + Intergenic
1019113373 6:169736930-169736952 TTGGAGTAGCAGAAGGAGATGGG - Intergenic
1019748726 7:2715365-2715387 TTGCAGAAGATGAAGGAAATCGG - Exonic
1021022839 7:15625128-15625150 ATATAGTAGATGAAGGAACTAGG - Intronic
1021891006 7:25186331-25186353 AGGGAGTAGCTGGAGGAATTTGG - Intergenic
1022130400 7:27399736-27399758 ATGCAGGAGCTGAAGGTATTAGG - Intergenic
1022323585 7:29309698-29309720 ATCAAGGAGCTGATGGGAATAGG + Intronic
1022791336 7:33692270-33692292 ATGAATTAGCTGTAGGAACTGGG + Intergenic
1025819913 7:64952974-64952996 ATGAAGTAGCCAAAGGAAACAGG - Intergenic
1026219708 7:68383061-68383083 ATGAATTGACTCAAGGAAATAGG - Intergenic
1027576094 7:79933012-79933034 TTGAGGTAGCTGAAAGAGATGGG - Intergenic
1027823022 7:83072656-83072678 ATGCTGTAGCTGAACGAAACTGG - Intronic
1028033994 7:85956268-85956290 CTGAGGTAACTGAATGAAATTGG - Intergenic
1028195413 7:87901607-87901629 TTGAGGTAGCAGAAAGAAATGGG + Intronic
1028267231 7:88741263-88741285 AAGAAGAAGATGAAAGAAATGGG - Intergenic
1028357823 7:89930510-89930532 ATGCAGTAGCTAAAGGAGAGAGG + Intergenic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1028653636 7:93177184-93177206 CAGAAGTAGCTGAAGAAAAGGGG + Intergenic
1028901040 7:96100823-96100845 ATAAAGAGGTTGAAGGAAATGGG + Intronic
1029027026 7:97427697-97427719 ATGCAGTAGATGAAAGAAGTAGG + Intergenic
1030407011 7:109127934-109127956 AAACAGTAGCTGAAAGAAATAGG + Intergenic
1030489249 7:110211428-110211450 CTGAAGGAGCTGAAAGAAACTGG - Intergenic
1030657472 7:112183895-112183917 ATTAACTAGGTGAAAGAAATAGG - Intronic
1031126218 7:117776197-117776219 ATGGATTAGATGAGGGAAATGGG - Intronic
1031235712 7:119173711-119173733 ATGAAGGAGCTGAAGAAAATTGG + Intergenic
1031332838 7:120487373-120487395 ATGAAGAAAGTGAAAGAAATGGG + Intronic
1031818038 7:126463790-126463812 TTGAACTAGCTGAGGGAAAGAGG - Intronic
1031971004 7:128065156-128065178 AAGAGGTAACTGATGGAAATGGG + Intronic
1034669532 7:152847602-152847624 ATGAAGTAGCTGAAGGAATCTGG + Intronic
1035964168 8:4171778-4171800 ATGAAGTTACTCAAGTAAATTGG - Intronic
1036715272 8:11116795-11116817 ATCAAGTGGTTGAAGGAAAAAGG - Intronic
1038003135 8:23407325-23407347 ATGAAGCATGTGAAGGAAAAGGG - Intronic
1039327464 8:36501077-36501099 ATAAAGTAGCAAAAGGACATGGG - Intergenic
1039383497 8:37108263-37108285 ATGAAGTATTTGAATGAAATTGG + Intergenic
1040095289 8:43436737-43436759 ATGAAGTAGATGAAGAAAATAGG + Intergenic
1043649762 8:82576753-82576775 ATGAGGTCTCTGATGGAAATAGG - Intergenic
1043993706 8:86787356-86787378 ATGAAGTAAGTGAAGGACAGTGG + Intergenic
1044215447 8:89604198-89604220 ATGAAGTAGCATGAAGAAATCGG + Intergenic
1044941767 8:97350807-97350829 CTGAAGCAGCTGAACGAAGTAGG + Intergenic
1045050070 8:98315851-98315873 TTGAAGTAGATGAAGAAAGTTGG + Intergenic
1045739760 8:105343405-105343427 AGGCAGTAGCTGAAGGAATTGGG + Intronic
1046193661 8:110832211-110832233 ATAAAGCAGCCAAAGGAAATAGG - Intergenic
1047607767 8:126491703-126491725 GTGAGGTAGGTGAAGGCAATGGG - Intergenic
1048491108 8:134894770-134894792 ATAAAGTAGCTTAAGCAAAGAGG + Intergenic
1048587545 8:135789455-135789477 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1048805203 8:138234673-138234695 ATGAAGTAGCTGAATACAAGAGG - Intronic
1048811160 8:138287719-138287741 ATGAAGTCACTAAAGGAGATGGG + Intronic
1050547866 9:6724098-6724120 ATGAAGTAGCTAGAAGAAAGAGG + Intronic
1051163070 9:14230645-14230667 AAAAATTAGCTGGAGGAAATGGG + Intronic
1051163629 9:14237275-14237297 ATGAGATAGATGAAAGAAATTGG - Intronic
1051896133 9:21990879-21990901 ATAAAATAGCTGAATGAAAGTGG + Intronic
1051930140 9:22375242-22375264 GTGGAATAGCTGAAGGAAACTGG - Intergenic
1052369397 9:27646706-27646728 TTGAAGTACCTGAAGGAGATGGG + Intergenic
1052713476 9:32087042-32087064 ATGATATAGCTGAGAGAAATTGG + Intergenic
1053618665 9:39794460-39794482 CTCAAGTAGCAGAAGGACATTGG - Intergenic
1053876842 9:42553822-42553844 CTCAAGTAGCAGAAGGACATTGG - Intergenic
1053895834 9:42740883-42740905 CTCAAGTAGCAGAAGGACATTGG + Intergenic
1054234855 9:62547900-62547922 CTCAAGTAGCAGAAGGACATTGG + Intergenic
1054265490 9:62912969-62912991 CTCAAGTAGCAGAAGGACATTGG + Intergenic
1056918961 9:90769443-90769465 AAGAAGTAGCTGATGAAAATTGG - Intergenic
1057837267 9:98455304-98455326 ATGAAGGAGCTGAGGGTAATGGG - Intronic
1058828952 9:108798412-108798434 ATAAAATAGCTTAGGGAAATAGG + Intergenic
1058942002 9:109822108-109822130 ATGAGCTAGCTCAAGGAAAAAGG + Intronic
1059596445 9:115725350-115725372 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1059918072 9:119126021-119126043 ATAAAGTAGCTGTGAGAAATGGG - Intergenic
1060685354 9:125606138-125606160 ATGTATTTCCTGAAGGAAATTGG - Intronic
1060748024 9:126150541-126150563 ATGAAGGAGGAAAAGGAAATAGG - Intergenic
1061039036 9:128128966-128128988 GTAAAGTGGCTGAAGGAAGTGGG - Intergenic
1061319227 9:129817390-129817412 ATCATGTAGCTGAAGAAAATGGG + Intronic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1185952636 X:4453161-4453183 TTGAAGTACCTGAAGGAGATGGG + Intergenic
1187145052 X:16629727-16629749 TTGAAAGAGCTGAAAGAAATGGG - Intronic
1187447165 X:19370095-19370117 AGCAAGGAGCTGAAGGAAAGGGG + Intronic
1188029320 X:25247001-25247023 ATGAAGCAGATGATGGAGATAGG + Intergenic
1189413461 X:40793609-40793631 ATGAGATAGCCGAGGGAAATAGG - Intergenic
1190712788 X:53081865-53081887 GGGAAGGAGCTGAAGGAAATGGG + Intergenic
1191204394 X:57819045-57819067 ATAAAGTAGCCAAAGGAAATAGG - Intergenic
1191638345 X:63402417-63402439 ATGTAGTGGCTGAATGAATTTGG - Intergenic
1192637691 X:72835169-72835191 ATGTGGAAGCTGAAGGAAACTGG + Intronic
1192644023 X:72885646-72885668 ATGTGGAAGCTGAAGGAAACTGG - Intronic
1192952080 X:76027631-76027653 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1193658805 X:84231639-84231661 ATGAAGTAGCTAGAGGAAAGTGG + Intergenic
1194058051 X:89162603-89162625 TTGGAGTACCTGAAGGAGATGGG - Intergenic
1194369514 X:93055200-93055222 ATAAAGTAACTGAGGTAAATAGG + Intergenic
1194496564 X:94623114-94623136 ATAAAATAACTAAAGGAAATTGG + Intergenic
1195147326 X:102030554-102030576 TTGAAGTATCTGAAGGAGACAGG + Intergenic
1195313700 X:103657797-103657819 AGGAGGTAGCTAATGGAAATGGG - Intergenic
1195350168 X:103988008-103988030 AGGAAGGAGTTGAGGGAAATGGG - Intergenic
1195351751 X:104003082-104003104 AGGAAGGAGTTGAGGGAAATGGG + Intergenic
1195357274 X:104050831-104050853 AGGAAGGAGTTGAGGGAAATGGG + Intergenic
1197029953 X:121801752-121801774 TTGAAGTACCTGAAGGAGACGGG - Intergenic
1198143378 X:133828986-133829008 ATAAAGTAACTGAATTAAATTGG + Intronic
1198252164 X:134890244-134890266 ATGAAGTAGCTAGATAAAATTGG + Intronic
1198700393 X:139391358-139391380 ATGAAGTAGCAGGAGGAGTTTGG - Intergenic
1198888571 X:141366854-141366876 TTGGAGTACCTGAAGGAGATGGG + Intergenic
1199411602 X:147530051-147530073 ATGAAATATATGAAGGAAACGGG - Intergenic
1200498861 Y:3920270-3920292 GGGAGGTAGCTGATGGAAATTGG - Intergenic
1200677705 Y:6171412-6171434 ATAAAGTAACTGAGGTAAATAGG + Intergenic
1200741869 Y:6863055-6863077 TTTGAGTACCTGAAGGAAATGGG - Intergenic
1201261387 Y:12162088-12162110 ATGAAATAGAAGAAGAAAATAGG - Intergenic
1201938205 Y:19430615-19430637 ATAAAGTAGCCAAAGGAAATAGG - Intergenic
1201958137 Y:19648513-19648535 ATGGAATAGTTGAAGGATATAGG - Intergenic
1202069868 Y:20979724-20979746 ATGAAATACCTGGAGGAAATAGG - Intergenic