ID: 1083104682

View in Genome Browser
Species Human (GRCh38)
Location 11:60346416-60346438
Sequence AAACTACAGCAGCAGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083104682_1083104685 -8 Left 1083104682 11:60346416-60346438 CCTATCACCTGCTGCTGTAGTTT 0: 1
1: 0
2: 3
3: 17
4: 196
Right 1083104685 11:60346431-60346453 TGTAGTTTCCTCTTAATGTTGGG 0: 1
1: 0
2: 2
3: 38
4: 332
1083104682_1083104684 -9 Left 1083104682 11:60346416-60346438 CCTATCACCTGCTGCTGTAGTTT 0: 1
1: 0
2: 3
3: 17
4: 196
Right 1083104684 11:60346430-60346452 CTGTAGTTTCCTCTTAATGTTGG 0: 1
1: 0
2: 3
3: 28
4: 214
1083104682_1083104688 23 Left 1083104682 11:60346416-60346438 CCTATCACCTGCTGCTGTAGTTT 0: 1
1: 0
2: 3
3: 17
4: 196
Right 1083104688 11:60346462-60346484 GTGTAATAAACTTGTTCTTTAGG 0: 3
1: 2
2: 25
3: 43
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083104682 Original CRISPR AAACTACAGCAGCAGGTGAT AGG (reversed) Intronic
900708023 1:4092722-4092744 AAACCTCAGAAGCAGGTAATGGG + Intergenic
904962116 1:34341736-34341758 AAACTATAGCAGCATCTGCTGGG - Intergenic
905280515 1:36846220-36846242 AAACAGCAGCAGCAGGAGACTGG - Intronic
909454922 1:75839548-75839570 AAAGTAGAGCAGCAGGGCATAGG + Intronic
910505640 1:87947351-87947373 AAAATACAGGTGGAGGTGATGGG + Intergenic
910906955 1:92191356-92191378 AAAATACAGCATCAGGGGCTGGG - Intergenic
911509149 1:98790421-98790443 AACATACAGCAACAGGAGATTGG - Intergenic
911679675 1:100700682-100700704 AGACTCCATCAGCTGGTGATTGG - Intergenic
912400827 1:109390424-109390446 AAACTAGAGCAGCAGCTCTTAGG - Intronic
912609633 1:111029960-111029982 AAACTACAGAAGCAAGCTATAGG + Intergenic
915323752 1:155070173-155070195 AAAGTACAGCTGCAGGGGAAGGG - Intergenic
916115996 1:161485522-161485544 AAACTGCAGAAGCAGGCTATAGG - Intergenic
917600740 1:176571206-176571228 AAACTTAAGGAGCAGGTAATGGG - Intronic
918381271 1:183957978-183958000 AAATTACAGCATAAGGTGATAGG - Intronic
918965659 1:191344260-191344282 AAGCTACAGGATCAAGTGATGGG - Intergenic
918966569 1:191357552-191357574 AAACAGCAGCAGCAGTTGAGTGG - Intergenic
919777830 1:201205765-201205787 AAACTGCCGCAGCAGGTGCATGG - Intronic
919930622 1:202219107-202219129 CAACAAGAGAAGCAGGTGATGGG - Intronic
920537091 1:206744883-206744905 TAACGACAGCAGCACGTGCTGGG + Intergenic
924711286 1:246531980-246532002 AAACTGCAGAAGCAGGCTATAGG + Intergenic
924833424 1:247623168-247623190 CAAGTACAGCAGCAGCTGTTGGG - Intergenic
924850516 1:247824521-247824543 AAACTACATAAGCAGGGTATGGG - Intergenic
1063094553 10:2898374-2898396 TAACCACAGCAGAAGGTGAAGGG + Intergenic
1063332006 10:5169074-5169096 AAACTACAAAAACAGGTCATAGG + Intergenic
1064369736 10:14741002-14741024 AAACTACAACAGGACCTGATTGG + Intronic
1064388212 10:14918232-14918254 AAAATACATCAACAGGTGAATGG + Intronic
1065774392 10:29105897-29105919 AATCTACAGCAGAAGATGAGAGG + Intergenic
1066299800 10:34086805-34086827 AAACTACACCAAGAGGTGAGTGG + Intergenic
1067344907 10:45430061-45430083 AAACTGAAGCAGCAGGTAAAGGG + Intronic
1067349713 10:45464989-45465011 AAAGTACAGCAAGAGGTCATGGG + Intronic
1068498569 10:57816356-57816378 AAAGTACAGCAGCAGGTGTTGGG - Intergenic
1068701478 10:60024565-60024587 AAACTACCGCAGCACATCATAGG - Intergenic
1069074419 10:64023315-64023337 AAACTAAAGCTGCAAGTGACTGG - Intergenic
1071902703 10:90137950-90137972 AAACTACAGAAGCAAGCTATAGG + Intergenic
1072403443 10:95128057-95128079 AAACTACAGAGGCAGGTTATAGG - Intergenic
1074258861 10:111831964-111831986 AAATCACAGCAGAAGGTGAAGGG + Intergenic
1074904064 10:117845212-117845234 AAAATACATTAGCAGATGATAGG + Intergenic
1076913809 10:133407882-133407904 AAAAATCAGCAGCAGGTAATCGG - Intronic
1078925249 11:15868974-15868996 AGACTTCAGCAGCAGTTGCTGGG + Intergenic
1081284029 11:41246105-41246127 AAACGGCAGCAGGAGGTGACAGG - Intronic
1081692275 11:45086601-45086623 AGACTAGAGCAGGAGGTGCTGGG - Intergenic
1083104682 11:60346416-60346438 AAACTACAGCAGCAGGTGATAGG - Intronic
1083591103 11:63895385-63895407 ACACTCCAGCAGGTGGTGATGGG + Intronic
1083934503 11:65863279-65863301 ACAGTTCAGCTGCAGGTGATGGG - Intronic
1084611318 11:70204894-70204916 AAAGTACACCAGAAGGTGAGCGG + Intronic
1088347599 11:108845682-108845704 CAAATACAGAAGCATGTGATAGG - Intronic
1088889119 11:114030837-114030859 AAAGTTCAGCAGCAGCTGTTCGG + Intergenic
1088952914 11:114588895-114588917 AAACTACAGAAGTAGGCTATAGG + Intronic
1089085358 11:115812540-115812562 ACACTACAGTAGCATGTGGTGGG - Intergenic
1089911202 11:122102237-122102259 AAAATACATCAGCAGGTCAGGGG + Intergenic
1090686912 11:129131729-129131751 AAACCACATCACCAGGTGAGTGG + Intronic
1091657488 12:2356122-2356144 AAGCTACTGCACCAGGTAATTGG - Intronic
1093595232 12:20951144-20951166 AAACTACAGAAGCAGGCTACAGG - Intergenic
1094701612 12:32875780-32875802 AGACTACAGCAGGAGGAGATGGG + Intronic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1095640217 12:44478487-44478509 AAACTACAGAAGCAGGCTATAGG + Intergenic
1100122214 12:91382133-91382155 AAATTACAGCAGCACTTGATTGG + Intergenic
1101328402 12:103737184-103737206 AAACGTCAGCAGTGGGTGATAGG - Intronic
1101564297 12:105891108-105891130 AATCTCCAACAACAGGTGATGGG - Intergenic
1102641614 12:114371950-114371972 ACACTACACCAGCAGGAGAAGGG + Intronic
1103098604 12:118152631-118152653 AAACCACAGCAGCAGGCGTCAGG + Intronic
1103886159 12:124202175-124202197 AATGTACAGCAGTAGGTGATGGG + Intronic
1106824851 13:33509440-33509462 AATGTACAGCAGCAAGTGTTTGG - Intergenic
1110062221 13:71056430-71056452 AAACTACAGCACCAGTGGAAAGG + Intergenic
1110507238 13:76301201-76301223 AATCTACCCCAGCCGGTGATGGG + Intergenic
1113186901 13:107697936-107697958 AAACTACAGAAGTAGGTGCAAGG - Intronic
1116914677 14:50512511-50512533 AAACTACAGCTCCCGCTGATAGG + Intronic
1118468061 14:66049397-66049419 AATCAACAGCAGCAAGTGATGGG - Intergenic
1118916742 14:70114079-70114101 AAACTAAAGCCCCAGGTTATTGG + Intronic
1119252563 14:73169283-73169305 AAGCTTAACCAGCAGGTGATGGG - Intronic
1119704771 14:76776711-76776733 ACACTTGAGCAGGAGGTGATAGG + Intronic
1120281141 14:82439352-82439374 CAATTACAGCAGAAGGTGAAGGG - Intergenic
1124036808 15:26060924-26060946 AAACAACAGCACCAGGTTAAAGG - Intergenic
1127284861 15:57523627-57523649 AAACTGCAGAAGGAGGTGAGGGG + Exonic
1133301179 16:4783815-4783837 AAACGACAGCAGCAGGGCACGGG + Intronic
1134323379 16:13184294-13184316 AAAGTACAGCTGCAGAAGATAGG - Intronic
1135476649 16:22782240-22782262 AAAATACAGCAGCAGGTAGATGG + Intergenic
1137542688 16:49376102-49376124 CTCCGACAGCAGCAGGTGATGGG + Intronic
1140233877 16:73141131-73141153 AAACTACAGTATTAGGTCATAGG - Intronic
1140343445 16:74188463-74188485 AAACCACATCAGGAGGTGTTTGG + Intergenic
1141699417 16:85635619-85635641 CAACTGCAGCAGCAGGAGCTGGG - Intronic
1143649416 17:8254271-8254293 GACCTCCAGCAGCAGGTCATTGG - Exonic
1146612515 17:34320283-34320305 ACGTTAAAGCAGCAGGTGATTGG - Exonic
1147344198 17:39777073-39777095 AAAATACAGCAGAATGAGATGGG - Intronic
1149163412 17:53722343-53722365 AAACTCCAGCAGAAGATGAAAGG - Intergenic
1149930369 17:60747475-60747497 AAACCACAGCAGAAAGTGAATGG - Intronic
1153777735 18:8468483-8468505 AAAATAGAACAGCAGGTGAAAGG + Intergenic
1155737682 18:29244152-29244174 AAATTACTGCAGAAGGTGAAGGG - Intergenic
1156714519 18:39991101-39991123 AAACTGCAGCAGGAAGTCATAGG + Intergenic
1156718688 18:40043545-40043567 GATTTACAGCAGGAGGTGATAGG + Intergenic
1163096804 19:15064499-15064521 AAAAGACATCAGCAGATGATTGG + Intergenic
1164053125 19:21599834-21599856 AAACTTGAGGAGCAGGTTATGGG - Intergenic
1164187129 19:22880288-22880310 AAACTGCAGAAGCAGGATATAGG + Intergenic
1164187613 19:22884569-22884591 AAACTACAGAAGCAAGCTATAGG + Intergenic
1166399296 19:42466198-42466220 AGACTACAGCTGCAGGTAACAGG - Intergenic
927766797 2:25817707-25817729 AAACTAGAACAGCAGGTAAGAGG + Intronic
929080068 2:38113652-38113674 AAACTTCAGCAGAAGGTGCAGGG + Intergenic
930155126 2:48099035-48099057 AAACTACACCAGCAGGTGACTGG - Intergenic
931103013 2:59023746-59023768 AAACTACTCCAGCAAGTAATAGG - Intergenic
931844108 2:66185039-66185061 AAACAAAAGCAGGAGGTGAGGGG + Intergenic
932421194 2:71602450-71602472 AGAGAAGAGCAGCAGGTGATGGG - Intronic
934908418 2:98227483-98227505 AAACAACATCAACAGGTGAATGG + Intronic
937726908 2:125177033-125177055 AAATTATAGAAGCAGATGATGGG - Intergenic
938027161 2:127959555-127959577 AAACTACACCAGCAGGGAAGAGG - Intronic
940989923 2:160086557-160086579 AAACTGCAGAAGCAGGCTATAGG - Intergenic
942517429 2:176768593-176768615 AAACAACAGCAGCAGGAGTTCGG - Intergenic
943022609 2:182593255-182593277 AAATTCCACCAGCAGGTGATAGG - Intergenic
943404982 2:187470685-187470707 AAACCACATGAGCAGGGGATTGG + Intronic
944484630 2:200192145-200192167 AAACTAACACAGCATGTGATGGG - Intergenic
945214521 2:207419495-207419517 AAAGCCCAGCAGCTGGTGATTGG - Intergenic
945617532 2:212091369-212091391 AAACTAAAACATCAGGTGATTGG + Intronic
946140609 2:217687617-217687639 CAAATACAGCTGCAGGTCATGGG - Intronic
949066889 2:241996563-241996585 AACCTTCAGGAGCAGGTGAATGG - Intergenic
1169916131 20:10685733-10685755 CAACTGCAGCAGCATGTGATGGG + Intergenic
1171220383 20:23391817-23391839 AACATACAGAAGCAGGTGGTGGG + Intronic
1171296798 20:24024088-24024110 AAAATACGGCAGCAGTTTATTGG - Intergenic
1173332853 20:42089684-42089706 AGACTACAGCAGCAGCAGAATGG + Intronic
1176038990 20:63054647-63054669 AGAGCACAGCAGCAGGTGAGTGG + Intergenic
1178880873 21:36449218-36449240 AAACAAGAGCAGCATGTGAGAGG - Intergenic
1179611003 21:42549992-42550014 AAAATACATCAGCAGGAGGTGGG - Intronic
1183978179 22:41525176-41525198 AAACTCCTGCAGCAGGGAATGGG - Exonic
949278006 3:2310071-2310093 AAACTACTGCAGTATTTGATTGG - Intronic
949513303 3:4784985-4785007 AAATTACAGAAGCAGGTGCTGGG + Intronic
951896766 3:27616948-27616970 AAAATACAGGAGCAGGAGAAGGG - Intergenic
952160881 3:30691744-30691766 AAACAACAGCAGCAGGGAGTGGG + Exonic
952472479 3:33671014-33671036 AAACTAGAGCAGCAGGAGATGGG - Intronic
952760102 3:36905906-36905928 GAAGGCCAGCAGCAGGTGATGGG + Intronic
953454979 3:43033676-43033698 AAATTACAAAAGCAGGTGCTTGG - Intronic
954931289 3:54284714-54284736 AAATTATTGCAGCAGGTAATTGG - Intronic
959098061 3:101977922-101977944 AAACTAAATCAGTAGGTGACAGG - Intergenic
959202050 3:103259639-103259661 AAATTCCAGCAGAAGGTGAAGGG + Intergenic
959672470 3:108994920-108994942 AAATTACATCACCAGGTGAGAGG - Intronic
960550364 3:118969584-118969606 GAACTAGAGCAGCAGGTACTAGG + Intronic
963325836 3:143862150-143862172 AAAATACTCCAGCAGGTGCTGGG + Intergenic
964590371 3:158356140-158356162 AAACTGCAGCTGCAGATGATGGG + Intronic
965819650 3:172672601-172672623 AAACTACAGAAGCAAGCTATGGG + Intronic
966623135 3:181987180-181987202 AAACTGCAGCAGCTGGGTATTGG - Intergenic
969978755 4:11132482-11132504 AAAGTACAGCACCATTTGATTGG - Intergenic
971137437 4:23884990-23885012 AAACTGCAATAGCATGTGATAGG + Intronic
972978367 4:44664383-44664405 AAACAACAGGACCAGGTGAGTGG - Intronic
976028253 4:80718362-80718384 AAACTACAGAAGTAGGAGAAAGG + Intronic
976502984 4:85813967-85813989 CAATTACAGCAGAAGGTGAAAGG + Intronic
976704282 4:88005697-88005719 AAACTGCAGGATCAGGTAATAGG + Intergenic
976883192 4:89955478-89955500 TAACCACAGCAGAAGGTGAAGGG + Intergenic
978716853 4:111855031-111855053 ATACTACAACACCAGGGGATAGG + Intergenic
981163097 4:141522326-141522348 AAAAGACAGCAGCAGTTGCTGGG + Intergenic
982115466 4:152095185-152095207 AGCCTACAGCAGCAGGTGTGAGG + Intergenic
982742792 4:159075063-159075085 AGAGTACATCAGCAGGAGATGGG - Intergenic
985784900 5:1888252-1888274 AAGCTGGAGCAGCAGGTGACCGG + Intergenic
987295035 5:16542372-16542394 ATACAACAGTAGCAGGTGACAGG + Intronic
988196741 5:28014274-28014296 AAACTACAGAAGCAAGTTACAGG + Intergenic
989788375 5:45359712-45359734 AACCTACAGCATCAGATGAAAGG + Intronic
990147310 5:52776451-52776473 AAGTTACAGCAGCAGGAGTTTGG - Intergenic
994680281 5:102878280-102878302 AAGCTACATCACTAGGTGATAGG - Intronic
995060465 5:107807386-107807408 AAATGACTGCAGCAGCTGATGGG - Intergenic
995716001 5:115082423-115082445 AAACTACAGAAGCAAGCTATAGG - Intergenic
997238128 5:132287103-132287125 AAACTCCTGCAGAAGGTGAAAGG - Intronic
998546921 5:143036881-143036903 AAACTGCAGCATAAGGTGACAGG - Intronic
999798225 5:155007919-155007941 AAGCTACTGCAGCAGGTGGTGGG - Intergenic
1000331375 5:160208526-160208548 TAACTATAGCAAGAGGTGATAGG + Intronic
1000934040 5:167286619-167286641 AAACTACAGCAGAAAATGAAAGG - Intronic
1001603095 5:172941863-172941885 AAACTAAGGCAGCAAGTGCTGGG + Intronic
1001721744 5:173862542-173862564 AAAATAGGGCAGAAGGTGATGGG + Intergenic
1003220257 6:4154885-4154907 ACTCTAGAGAAGCAGGTGATTGG - Intergenic
1004962605 6:20807834-20807856 AAACTACAGCAACAGTTTTTTGG + Intronic
1007335997 6:41155626-41155648 AGACTACAGCAGCTGGGGATGGG + Intergenic
1011505813 6:88042631-88042653 AAAGTACAGCAAAAGGTGAATGG + Intergenic
1013418421 6:109945168-109945190 AAAAGCCAGCAGCAGGTGACAGG - Intergenic
1014747293 6:125214772-125214794 AAACTACAGCAGCATGAAATTGG - Intronic
1015440854 6:133243486-133243508 AAACTTCAGAAGCTGCTGATGGG - Intronic
1016797602 6:148134421-148134443 GGACTAAGGCAGCAGGTGATGGG - Intergenic
1028251640 7:88545113-88545135 AAACTGCAGAAGCAGGCTATAGG - Intergenic
1029518708 7:101045986-101046008 AAACAACAGAAGCAGATGCTGGG - Intronic
1029787754 7:102809765-102809787 AAACTACATCACCAAGAGATAGG - Intergenic
1036114771 8:5946620-5946642 AAACCACATCAACAGGTGAGAGG + Intergenic
1036727532 8:11232811-11232833 GAACTATAGCACCAGGTGTTAGG - Intergenic
1039649687 8:39328283-39328305 AAACTACAGAAGCAAGCTATAGG - Intergenic
1040772600 8:50996273-50996295 AAACCACAGCAGCATGTAAAAGG + Intergenic
1040946874 8:52893642-52893664 AAACTACGGCACCAGGAGGTGGG - Intergenic
1046193793 8:110833297-110833319 AAACTACAGAAGCAAGTTATAGG - Intergenic
1046752711 8:117942055-117942077 AGACGGTAGCAGCAGGTGATGGG - Intronic
1048201660 8:132379642-132379664 AAATTACAGCAGAAGGCAATTGG - Intronic
1048331076 8:133471145-133471167 AACCAACAGCAGCTGGGGATTGG - Intronic
1049568824 8:143358786-143358808 AAAACACAGCAGCAGCTGAGAGG + Intronic
1052980397 9:34444191-34444213 AAATTGCAGCAGCTGGTGAAAGG - Intronic
1056070036 9:82976739-82976761 AAACTACAAGATCTGGTGATAGG - Intergenic
1056966039 9:91163645-91163667 ACACTACAGTGGCACGTGATGGG + Intergenic
1057725895 9:97567919-97567941 AAAAGACACCAGCAGCTGATAGG - Intronic
1186002861 X:5033642-5033664 ATACTACTGCAGCAGGGCATTGG + Intergenic
1187694448 X:21904674-21904696 AGACTACAGTAGCAGGTGCCAGG - Intergenic
1187922143 X:24215226-24215248 CAAATACAGCAGCATGTTATCGG - Exonic
1188297495 X:28467801-28467823 AAACTAGAGCAGCAGGAATTTGG - Intergenic
1190383700 X:49863773-49863795 AAAATACAAAAGCAGGGGATGGG - Intergenic
1190492938 X:51001071-51001093 TAACTGCACCAGCAGCTGATTGG - Intergenic
1190511698 X:51179496-51179518 TAACTGCACCAGCAGCTGATTGG + Intergenic
1190513137 X:51194738-51194760 CAACTGCAGCAGAAGGTGAAAGG + Intergenic
1191169517 X:57428508-57428530 AAACTACAACAGCATGGTATTGG + Intronic
1193239701 X:79153390-79153412 AAACTGGAGCAGCAGGAAATGGG + Intergenic
1193348338 X:80429758-80429780 AAACTACAAAAGCAGGCTATGGG - Intronic
1193530467 X:82648995-82649017 AAACTGCAGAAGCAGGCTATAGG - Intergenic
1193867430 X:86752286-86752308 AAACCACACTAGCAGGTGAAAGG + Intronic
1193984748 X:88227360-88227382 AAACTACAGATGCAGGGGAGTGG - Intergenic
1194391487 X:93322643-93322665 AAACTGCAGCTGCAGGAGGTGGG + Intergenic
1194406774 X:93506057-93506079 AACGTACAACAGCAGGTGAATGG + Intergenic
1196555944 X:117084359-117084381 TAACTCCATCAACAGGTGATGGG + Intergenic
1197098628 X:122625132-122625154 AAATCACAGCAGAAGGTGAAGGG + Intergenic
1197959277 X:131986371-131986393 AAATTAGAGCTTCAGGTGATTGG + Intergenic
1199394394 X:147317615-147317637 AAACAACAACAGCATGAGATTGG - Intergenic
1199840489 X:151642251-151642273 AAAAAACACGAGCAGGTGATTGG - Intronic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200150219 X:153947708-153947730 AAACAACAGGACCAGGTGAGTGG + Exonic
1200971501 Y:9157502-9157524 AAACTACAAAAGCAGGCCATGGG + Intergenic
1201652322 Y:16303362-16303384 AAACTCCAGCAACATGGGATTGG + Intergenic
1201793084 Y:17863925-17863947 AAACTACAGAAGCAGGCTGTGGG + Intergenic
1201808470 Y:18042061-18042083 AAACTACAGAAGCAGGCTGTGGG - Intergenic
1202354617 Y:24033169-24033191 AAACTACAGAAGCAGGCTGTGGG + Intergenic
1202516161 Y:25636943-25636965 AAACTACAGAAGCAGGCTGTGGG - Intergenic